ID: 1035728984

View in Genome Browser
Species Human (GRCh38)
Location 8:1841849-1841871
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035728984_1035728995 6 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728995 8:1841878-1841900 ACTGGGGCCGCGGCGGGAACTGG No data
1035728984_1035729004 26 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729004 8:1841898-1841920 TGGGGCCGCGGCGGGAACTGGGG No data
1035728984_1035729003 25 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729003 8:1841897-1841919 CTGGGGCCGCGGCGGGAACTGGG No data
1035728984_1035728997 8 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728997 8:1841880-1841902 TGGGGCCGCGGCGGGAACTGGGG No data
1035728984_1035729001 18 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG No data
1035728984_1035728994 0 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG No data
1035728984_1035728996 7 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728996 8:1841879-1841901 CTGGGGCCGCGGCGGGAACTGGG No data
1035728984_1035729000 17 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729000 8:1841889-1841911 GGCGGGAACTGGGGCCGCGGCGG No data
1035728984_1035728999 14 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728999 8:1841886-1841908 CGCGGCGGGAACTGGGGCCGCGG No data
1035728984_1035729002 24 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729002 8:1841896-1841918 ACTGGGGCCGCGGCGGGAACTGG No data
1035728984_1035728993 -1 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728993 8:1841871-1841893 GGCGGGAACTGGGGCCGCGGCGG No data
1035728984_1035728990 -10 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728990 8:1841862-1841884 TGGGGCCGCGGCGGGAACTGGGG No data
1035728984_1035728992 -4 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728992 8:1841868-1841890 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035728984 Original CRISPR CGCGGCCCCAGTTCCCGCCG CGG (reversed) Intronic