ID: 1035728991

View in Genome Browser
Species Human (GRCh38)
Location 8:1841867-1841889
Sequence CGCGGCCCCAGTTCCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035728991_1035729008 18 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729008 8:1841908-1841930 GCGGGAACTGGGGCCGCGGCGGG No data
1035728991_1035729000 -1 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729000 8:1841889-1841911 GGCGGGAACTGGGGCCGCGGCGG No data
1035728991_1035729007 17 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729007 8:1841907-1841929 GGCGGGAACTGGGGCCGCGGCGG No data
1035728991_1035728997 -10 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728997 8:1841880-1841902 TGGGGCCGCGGCGGGAACTGGGG No data
1035728991_1035728999 -4 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035728999 8:1841886-1841908 CGCGGCGGGAACTGGGGCCGCGG No data
1035728991_1035729003 7 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729003 8:1841897-1841919 CTGGGGCCGCGGCGGGAACTGGG No data
1035728991_1035729002 6 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729002 8:1841896-1841918 ACTGGGGCCGCGGCGGGAACTGG No data
1035728991_1035729011 26 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729011 8:1841916-1841938 TGGGGCCGCGGCGGGAACTGGGG No data
1035728991_1035729001 0 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG No data
1035728991_1035729009 24 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729009 8:1841914-1841936 ACTGGGGCCGCGGCGGGAACTGG No data
1035728991_1035729004 8 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729004 8:1841898-1841920 TGGGGCCGCGGCGGGAACTGGGG No data
1035728991_1035729010 25 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729010 8:1841915-1841937 CTGGGGCCGCGGCGGGAACTGGG No data
1035728991_1035729006 14 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729006 8:1841904-1841926 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035728991 Original CRISPR CGCGGCCCCAGTTCCCGCCG CGG (reversed) Intronic