ID: 1035728994

View in Genome Browser
Species Human (GRCh38)
Location 8:1841872-1841894
Sequence GCGGGAACTGGGGCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035728984_1035728994 0 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG 0: 12
1: 1
2: 4
3: 14
4: 156
Right 1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG No data
1035728977_1035728994 18 Left 1035728977 8:1841831-1841853 CCGCGACGGGAACTGGGGCCGCG 0: 1
1: 14
2: 1
3: 6
4: 46
Right 1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035728994 Original CRISPR GCGGGAACTGGGGCCGCGGC GGG Intronic
No off target data available for this crispr