ID: 1035728998

View in Genome Browser
Species Human (GRCh38)
Location 8:1841885-1841907
Sequence CGCGGCCCCAGTTCCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035728998_1035729009 6 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729009 8:1841914-1841936 ACTGGGGCCGCGGCGGGAACTGG No data
1035728998_1035729008 0 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729008 8:1841908-1841930 GCGGGAACTGGGGCCGCGGCGGG No data
1035728998_1035729016 26 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729016 8:1841934-1841956 TGGGGCCGCGACCGGAACTGGGG No data
1035728998_1035729011 8 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729011 8:1841916-1841938 TGGGGCCGCGGCGGGAACTGGGG No data
1035728998_1035729013 18 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729013 8:1841926-1841948 GCGGGAACTGGGGCCGCGACCGG No data
1035728998_1035729014 24 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729014 8:1841932-1841954 ACTGGGGCCGCGACCGGAACTGG No data
1035728998_1035729004 -10 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729004 8:1841898-1841920 TGGGGCCGCGGCGGGAACTGGGG No data
1035728998_1035729007 -1 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729007 8:1841907-1841929 GGCGGGAACTGGGGCCGCGGCGG No data
1035728998_1035729015 25 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729015 8:1841933-1841955 CTGGGGCCGCGACCGGAACTGGG No data
1035728998_1035729010 7 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729010 8:1841915-1841937 CTGGGGCCGCGGCGGGAACTGGG No data
1035728998_1035729006 -4 Left 1035728998 8:1841885-1841907 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729006 8:1841904-1841926 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035728998 Original CRISPR CGCGGCCCCAGTTCCCGCCG CGG (reversed) Intronic