ID: 1035729001

View in Genome Browser
Species Human (GRCh38)
Location 8:1841890-1841912
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035728991_1035729001 0 Left 1035728991 8:1841867-1841889 CCGCGGCGGGAACTGGGGCCGCG 0: 12
1: 1
2: 4
3: 14
4: 156
Right 1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG No data
1035728984_1035729001 18 Left 1035728984 8:1841849-1841871 CCGCGGCGGGAACTGGGGCCGCG 0: 12
1: 1
2: 4
3: 14
4: 156
Right 1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr