ID: 1035729017

View in Genome Browser
Species Human (GRCh38)
Location 8:1841939-1841961
Sequence CGCGGCCCCAGTTCCGGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729017_1035729034 18 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729017_1035729030 8 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729030 8:1841970-1841992 TGGGGCCGCGGCGGGAACTGGGG No data
1035729017_1035729025 -1 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729025 8:1841961-1841983 GACCGGAACTGGGGCCGCGGCGG No data
1035729017_1035729037 26 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729037 8:1841988-1842010 TGGGGCCGCGGCGGGAACTGGGG No data
1035729017_1035729036 25 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729036 8:1841987-1842009 CTGGGGCCGCGGCGGGAACTGGG No data
1035729017_1035729033 17 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729033 8:1841979-1842001 GGCGGGAACTGGGGCCGCGGCGG No data
1035729017_1035729032 14 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729017_1035729028 6 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729028 8:1841968-1841990 ACTGGGGCCGCGGCGGGAACTGG No data
1035729017_1035729035 24 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729035 8:1841986-1842008 ACTGGGGCCGCGGCGGGAACTGG No data
1035729017_1035729029 7 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729029 8:1841969-1841991 CTGGGGCCGCGGCGGGAACTGGG No data
1035729017_1035729026 0 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729026 8:1841962-1841984 ACCGGAACTGGGGCCGCGGCGGG No data
1035729017_1035729022 -10 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729022 8:1841952-1841974 TGGGGCCGCGACCGGAACTGGGG No data
1035729017_1035729024 -4 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729024 8:1841958-1841980 CGCGACCGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729017 Original CRISPR CGCGGCCCCAGTTCCGGTCG CGG (reversed) Intronic