ID: 1035729019

View in Genome Browser
Species Human (GRCh38)
Location 8:1841945-1841967
Sequence TCCGGTCGCGGCCCCAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729019_1035729041 30 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729019_1035729033 11 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729033 8:1841979-1842001 GGCGGGAACTGGGGCCGCGGCGG No data
1035729019_1035729025 -7 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729025 8:1841961-1841983 GACCGGAACTGGGGCCGCGGCGG No data
1035729019_1035729040 29 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729040 8:1841997-1842019 GGCGGGAACTGGGGCCGCGGCGG No data
1035729019_1035729028 0 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729028 8:1841968-1841990 ACTGGGGCCGCGGCGGGAACTGG No data
1035729019_1035729032 8 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729019_1035729030 2 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729030 8:1841970-1841992 TGGGGCCGCGGCGGGAACTGGGG No data
1035729019_1035729037 20 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729037 8:1841988-1842010 TGGGGCCGCGGCGGGAACTGGGG No data
1035729019_1035729026 -6 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729026 8:1841962-1841984 ACCGGAACTGGGGCCGCGGCGGG No data
1035729019_1035729029 1 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729029 8:1841969-1841991 CTGGGGCCGCGGCGGGAACTGGG No data
1035729019_1035729036 19 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729036 8:1841987-1842009 CTGGGGCCGCGGCGGGAACTGGG No data
1035729019_1035729024 -10 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729024 8:1841958-1841980 CGCGACCGGAACTGGGGCCGCGG No data
1035729019_1035729039 26 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729039 8:1841994-1842016 CGCGGCGGGAACTGGGGCCGCGG No data
1035729019_1035729034 12 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729019_1035729035 18 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729035 8:1841986-1842008 ACTGGGGCCGCGGCGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729019 Original CRISPR TCCGGTCGCGGCCCCAGTTC CGG (reversed) Intronic