ID: 1035729023

View in Genome Browser
Species Human (GRCh38)
Location 8:1841957-1841979
Sequence CGCGGCCCCAGTTCCGGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729023_1035729033 -1 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729033 8:1841979-1842001 GGCGGGAACTGGGGCCGCGGCGG No data
1035729023_1035729041 18 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729023_1035729037 8 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729037 8:1841988-1842010 TGGGGCCGCGGCGGGAACTGGGG No data
1035729023_1035729036 7 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729036 8:1841987-1842009 CTGGGGCCGCGGCGGGAACTGGG No data
1035729023_1035729040 17 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729040 8:1841997-1842019 GGCGGGAACTGGGGCCGCGGCGG No data
1035729023_1035729030 -10 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729030 8:1841970-1841992 TGGGGCCGCGGCGGGAACTGGGG No data
1035729023_1035729034 0 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729023_1035729042 24 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729042 8:1842004-1842026 ACTGGGGCCGCGGCGGGAACTGG No data
1035729023_1035729035 6 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729035 8:1841986-1842008 ACTGGGGCCGCGGCGGGAACTGG No data
1035729023_1035729039 14 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729039 8:1841994-1842016 CGCGGCGGGAACTGGGGCCGCGG No data
1035729023_1035729032 -4 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729023_1035729043 25 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729043 8:1842005-1842027 CTGGGGCCGCGGCGGGAACTGGG No data
1035729023_1035729044 26 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729023 Original CRISPR CGCGGCCCCAGTTCCGGTCG CGG (reversed) Intronic