ID: 1035729027

View in Genome Browser
Species Human (GRCh38)
Location 8:1841963-1841985
Sequence TCCCGCCGCGGCCCCAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729027_1035729033 -7 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729033 8:1841979-1842001 GGCGGGAACTGGGGCCGCGGCGG No data
1035729027_1035729040 11 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729040 8:1841997-1842019 GGCGGGAACTGGGGCCGCGGCGG No data
1035729027_1035729036 1 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729036 8:1841987-1842009 CTGGGGCCGCGGCGGGAACTGGG No data
1035729027_1035729044 20 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data
1035729027_1035729042 18 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729042 8:1842004-1842026 ACTGGGGCCGCGGCGGGAACTGG No data
1035729027_1035729043 19 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729043 8:1842005-1842027 CTGGGGCCGCGGCGGGAACTGGG No data
1035729027_1035729046 26 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729046 8:1842012-1842034 CGCGGCGGGAACTGGGGCCGCGG No data
1035729027_1035729041 12 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729027_1035729048 30 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG No data
1035729027_1035729047 29 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729047 8:1842015-1842037 GGCGGGAACTGGGGCCGCGGCGG No data
1035729027_1035729032 -10 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729027_1035729037 2 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729037 8:1841988-1842010 TGGGGCCGCGGCGGGAACTGGGG No data
1035729027_1035729035 0 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729035 8:1841986-1842008 ACTGGGGCCGCGGCGGGAACTGG No data
1035729027_1035729034 -6 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729027_1035729039 8 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729039 8:1841994-1842016 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729027 Original CRISPR TCCCGCCGCGGCCCCAGTTC CGG (reversed) Intronic