ID: 1035729031

View in Genome Browser
Species Human (GRCh38)
Location 8:1841975-1841997
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729031_1035729047 17 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729047 8:1842015-1842037 GGCGGGAACTGGGGCCGCGGCGG No data
1035729031_1035729051 26 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729051 8:1842024-1842046 TGGGGCCGCGGCGGGAACTGGGG No data
1035729031_1035729042 6 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729042 8:1842004-1842026 ACTGGGGCCGCGGCGGGAACTGG No data
1035729031_1035729037 -10 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729037 8:1841988-1842010 TGGGGCCGCGGCGGGAACTGGGG No data
1035729031_1035729049 24 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729049 8:1842022-1842044 ACTGGGGCCGCGGCGGGAACTGG No data
1035729031_1035729046 14 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729046 8:1842012-1842034 CGCGGCGGGAACTGGGGCCGCGG No data
1035729031_1035729044 8 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data
1035729031_1035729050 25 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729050 8:1842023-1842045 CTGGGGCCGCGGCGGGAACTGGG No data
1035729031_1035729039 -4 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729039 8:1841994-1842016 CGCGGCGGGAACTGGGGCCGCGG No data
1035729031_1035729043 7 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729043 8:1842005-1842027 CTGGGGCCGCGGCGGGAACTGGG No data
1035729031_1035729040 -1 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729040 8:1841997-1842019 GGCGGGAACTGGGGCCGCGGCGG No data
1035729031_1035729041 0 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729031_1035729048 18 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729031 Original CRISPR CGCGGCCCCAGTTCCCGCCG CGG (reversed) Intronic