ID: 1035729032

View in Genome Browser
Species Human (GRCh38)
Location 8:1841976-1841998
Sequence CGCGGCGGGAACTGGGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729027_1035729032 -10 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729017_1035729032 14 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729023_1035729032 -4 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data
1035729019_1035729032 8 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA No data
Right 1035729032 8:1841976-1841998 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729032 Original CRISPR CGCGGCGGGAACTGGGGCCG CGG Intronic