ID: 1035729034

View in Genome Browser
Species Human (GRCh38)
Location 8:1841980-1842002
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729019_1035729034 12 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729017_1035729034 18 Left 1035729017 8:1841939-1841961 CCGCGACCGGAACTGGGGCCGCG 0: 2
1: 1
2: 13
3: 6
4: 56
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729023_1035729034 0 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG 0: 2
1: 1
2: 13
3: 6
4: 56
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data
1035729027_1035729034 -6 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA 0: 1
1: 1
2: 2
3: 7
4: 172
Right 1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr