ID: 1035729038

View in Genome Browser
Species Human (GRCh38)
Location 8:1841993-1842015
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729038_1035729057 25 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729057 8:1842041-1842063 CTGGGGCCGCGGCGGGAACTGGG No data
1035729038_1035729054 17 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729054 8:1842033-1842055 GGCGGGAACTGGGGCCGCGGCGG No data
1035729038_1035729055 18 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729055 8:1842034-1842056 GCGGGAACTGGGGCCGCGGCGGG No data
1035729038_1035729049 6 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729049 8:1842022-1842044 ACTGGGGCCGCGGCGGGAACTGG No data
1035729038_1035729056 24 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729056 8:1842040-1842062 ACTGGGGCCGCGGCGGGAACTGG No data
1035729038_1035729048 0 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG No data
1035729038_1035729047 -1 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729047 8:1842015-1842037 GGCGGGAACTGGGGCCGCGGCGG No data
1035729038_1035729058 26 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729058 8:1842042-1842064 TGGGGCCGCGGCGGGAACTGGGG No data
1035729038_1035729053 14 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729053 8:1842030-1842052 CGCGGCGGGAACTGGGGCCGCGG No data
1035729038_1035729044 -10 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data
1035729038_1035729046 -4 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729046 8:1842012-1842034 CGCGGCGGGAACTGGGGCCGCGG No data
1035729038_1035729051 8 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729051 8:1842024-1842046 TGGGGCCGCGGCGGGAACTGGGG No data
1035729038_1035729050 7 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729050 8:1842023-1842045 CTGGGGCCGCGGCGGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729038 Original CRISPR CGCGGCCCCAGTTCCCGCCG CGG (reversed) Intronic