ID: 1035729041

View in Genome Browser
Species Human (GRCh38)
Location 8:1841998-1842020
Sequence GCGGGAACTGGGGCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729027_1035729041 12 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA 0: 1
1: 1
2: 2
3: 7
4: 172
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729019_1035729041 30 Left 1035729019 8:1841945-1841967 CCGGAACTGGGGCCGCGACCGGA 0: 1
1: 0
2: 1
3: 8
4: 62
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729023_1035729041 18 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG 0: 2
1: 1
2: 13
3: 6
4: 56
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data
1035729031_1035729041 0 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG 0: 12
1: 1
2: 4
3: 14
4: 156
Right 1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729041 Original CRISPR GCGGGAACTGGGGCCGCGGC GGG Intronic
No off target data available for this crispr