ID: 1035729044

View in Genome Browser
Species Human (GRCh38)
Location 8:1842006-1842028
Sequence TGGGGCCGCGGCGGGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729038_1035729044 -10 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data
1035729031_1035729044 8 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data
1035729027_1035729044 20 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data
1035729023_1035729044 26 Left 1035729023 8:1841957-1841979 CCGCGACCGGAACTGGGGCCGCG No data
Right 1035729044 8:1842006-1842028 TGGGGCCGCGGCGGGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729044 Original CRISPR TGGGGCCGCGGCGGGAACTG GGG Intronic