ID: 1035729045

View in Genome Browser
Species Human (GRCh38)
Location 8:1842011-1842033
Sequence CGCGGCCCCAGTTCCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729045_1035729054 -1 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729054 8:1842033-1842055 GGCGGGAACTGGGGCCGCGGCGG No data
1035729045_1035729058 8 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729058 8:1842042-1842064 TGGGGCCGCGGCGGGAACTGGGG No data
1035729045_1035729061 17 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729061 8:1842051-1842073 GGCGGGAACTGGGGCCGCGGCGG No data
1035729045_1035729057 7 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729057 8:1842041-1842063 CTGGGGCCGCGGCGGGAACTGGG No data
1035729045_1035729063 24 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729063 8:1842058-1842080 ACTGGGGCCGCGGCGGGAACTGG No data
1035729045_1035729062 18 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG No data
1035729045_1035729065 26 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729065 8:1842060-1842082 TGGGGCCGCGGCGGGAACTGGGG No data
1035729045_1035729064 25 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729064 8:1842059-1842081 CTGGGGCCGCGGCGGGAACTGGG No data
1035729045_1035729055 0 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729055 8:1842034-1842056 GCGGGAACTGGGGCCGCGGCGGG No data
1035729045_1035729051 -10 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729051 8:1842024-1842046 TGGGGCCGCGGCGGGAACTGGGG No data
1035729045_1035729053 -4 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729053 8:1842030-1842052 CGCGGCGGGAACTGGGGCCGCGG No data
1035729045_1035729056 6 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729056 8:1842040-1842062 ACTGGGGCCGCGGCGGGAACTGG No data
1035729045_1035729060 14 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729060 8:1842048-1842070 CGCGGCGGGAACTGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729045 Original CRISPR CGCGGCCCCAGTTCCCGCCG CGG (reversed) Intronic