ID: 1035729047

View in Genome Browser
Species Human (GRCh38)
Location 8:1842015-1842037
Sequence GGCGGGAACTGGGGCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729031_1035729047 17 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729047 8:1842015-1842037 GGCGGGAACTGGGGCCGCGGCGG No data
1035729027_1035729047 29 Left 1035729027 8:1841963-1841985 CCGGAACTGGGGCCGCGGCGGGA No data
Right 1035729047 8:1842015-1842037 GGCGGGAACTGGGGCCGCGGCGG No data
1035729038_1035729047 -1 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729047 8:1842015-1842037 GGCGGGAACTGGGGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729047 Original CRISPR GGCGGGAACTGGGGCCGCGG CGG Intronic