ID: 1035729049

View in Genome Browser
Species Human (GRCh38)
Location 8:1842022-1842044
Sequence ACTGGGGCCGCGGCGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729031_1035729049 24 Left 1035729031 8:1841975-1841997 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729049 8:1842022-1842044 ACTGGGGCCGCGGCGGGAACTGG No data
1035729038_1035729049 6 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729049 8:1842022-1842044 ACTGGGGCCGCGGCGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729049 Original CRISPR ACTGGGGCCGCGGCGGGAAC TGG Intronic