ID: 1035729053 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:1842030-1842052 |
Sequence | CGCGGCGGGAACTGGGGCCG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035729038_1035729053 | 14 | Left | 1035729038 | 8:1841993-1842015 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
Right | 1035729053 | 8:1842030-1842052 | CGCGGCGGGAACTGGGGCCGCGG | No data | ||||
1035729045_1035729053 | -4 | Left | 1035729045 | 8:1842011-1842033 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
Right | 1035729053 | 8:1842030-1842052 | CGCGGCGGGAACTGGGGCCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035729053 | Original CRISPR | CGCGGCGGGAACTGGGGCCG CGG | Intronic | ||