ID: 1035729054 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:1842033-1842055 |
| Sequence | GGCGGGAACTGGGGCCGCGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035729038_1035729054 | 17 | Left | 1035729038 | 8:1841993-1842015 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
| Right | 1035729054 | 8:1842033-1842055 | GGCGGGAACTGGGGCCGCGGCGG | No data | ||||
| 1035729045_1035729054 | -1 | Left | 1035729045 | 8:1842011-1842033 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
| Right | 1035729054 | 8:1842033-1842055 | GGCGGGAACTGGGGCCGCGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035729054 | Original CRISPR | GGCGGGAACTGGGGCCGCGG CGG | Intronic | ||