ID: 1035729056

View in Genome Browser
Species Human (GRCh38)
Location 8:1842040-1842062
Sequence ACTGGGGCCGCGGCGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729045_1035729056 6 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729056 8:1842040-1842062 ACTGGGGCCGCGGCGGGAACTGG No data
1035729038_1035729056 24 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729056 8:1842040-1842062 ACTGGGGCCGCGGCGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729056 Original CRISPR ACTGGGGCCGCGGCGGGAAC TGG Intronic