ID: 1035729058

View in Genome Browser
Species Human (GRCh38)
Location 8:1842042-1842064
Sequence TGGGGCCGCGGCGGGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729052_1035729058 -10 Left 1035729052 8:1842029-1842051 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729058 8:1842042-1842064 TGGGGCCGCGGCGGGAACTGGGG No data
1035729038_1035729058 26 Left 1035729038 8:1841993-1842015 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729058 8:1842042-1842064 TGGGGCCGCGGCGGGAACTGGGG No data
1035729045_1035729058 8 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG No data
Right 1035729058 8:1842042-1842064 TGGGGCCGCGGCGGGAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729058 Original CRISPR TGGGGCCGCGGCGGGAACTG GGG Intronic