ID: 1035729060 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:1842048-1842070 |
Sequence | CGCGGCGGGAACTGGGGCCG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035729052_1035729060 | -4 | Left | 1035729052 | 8:1842029-1842051 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
Right | 1035729060 | 8:1842048-1842070 | CGCGGCGGGAACTGGGGCCGCGG | No data | ||||
1035729045_1035729060 | 14 | Left | 1035729045 | 8:1842011-1842033 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
Right | 1035729060 | 8:1842048-1842070 | CGCGGCGGGAACTGGGGCCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035729060 | Original CRISPR | CGCGGCGGGAACTGGGGCCG CGG | Intronic | ||