ID: 1035729062

View in Genome Browser
Species Human (GRCh38)
Location 8:1842052-1842074
Sequence GCGGGAACTGGGGCCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035729045_1035729062 18 Left 1035729045 8:1842011-1842033 CCGCGGCGGGAACTGGGGCCGCG 0: 12
1: 1
2: 4
3: 14
4: 156
Right 1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG No data
1035729052_1035729062 0 Left 1035729052 8:1842029-1842051 CCGCGGCGGGAACTGGGGCCGCG 0: 12
1: 1
2: 4
3: 14
4: 156
Right 1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035729062 Original CRISPR GCGGGAACTGGGGCCGCGGC GGG Intronic
No off target data available for this crispr