ID: 1035729067 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:1842068-1842090 |
| Sequence | CGGCGGGAACTGGGGCCGCG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035729052_1035729067 | 16 | Left | 1035729052 | 8:1842029-1842051 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
| Right | 1035729067 | 8:1842068-1842090 | CGGCGGGAACTGGGGCCGCGAGG | No data | ||||
| 1035729059_1035729067 | -2 | Left | 1035729059 | 8:1842047-1842069 | CCGCGGCGGGAACTGGGGCCGCG | No data | ||
| Right | 1035729067 | 8:1842068-1842090 | CGGCGGGAACTGGGGCCGCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035729067 | Original CRISPR | CGGCGGGAACTGGGGCCGCG AGG | Intronic | ||