ID: 1035732034

View in Genome Browser
Species Human (GRCh38)
Location 8:1860232-1860254
Sequence TCCTCTCCACGCCCCCGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035732022_1035732034 14 Left 1035732022 8:1860195-1860217 CCTCCTCTCCACGCCCCCGAAGT 0: 2
1: 0
2: 2
3: 13
4: 203
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732024_1035732034 11 Left 1035732024 8:1860198-1860220 CCTCTCCACGCCCCCGAAGTGGC 0: 2
1: 0
2: 4
3: 15
4: 119
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732025_1035732034 6 Left 1035732025 8:1860203-1860225 CCACGCCCCCGAAGTGGCCTGTG 0: 2
1: 0
2: 3
3: 7
4: 92
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732021_1035732034 15 Left 1035732021 8:1860194-1860216 CCCTCCTCTCCACGCCCCCGAAG 0: 2
1: 1
2: 0
3: 15
4: 226
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732028_1035732034 0 Left 1035732028 8:1860209-1860231 CCCCGAAGTGGCCTGTGGTTCCC 0: 2
1: 0
2: 2
3: 6
4: 104
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732030_1035732034 -2 Left 1035732030 8:1860211-1860233 CCGAAGTGGCCTGTGGTTCCCTC 0: 2
1: 0
2: 1
3: 13
4: 145
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732027_1035732034 1 Left 1035732027 8:1860208-1860230 CCCCCGAAGTGGCCTGTGGTTCC 0: 2
1: 2
2: 2
3: 4
4: 95
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104
1035732029_1035732034 -1 Left 1035732029 8:1860210-1860232 CCCGAAGTGGCCTGTGGTTCCCT 0: 2
1: 0
2: 12
3: 18
4: 185
Right 1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG 0: 2
1: 0
2: 2
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035732034 Original CRISPR TCCTCTCCACGCCCCCGAAG TGG Intronic
900307569 1:2018817-2018839 TCCTCTCCCCGCCCCCGTCGAGG + Intergenic
900830040 1:4959398-4959420 TCCTCTCCACTCCCGGGAAGGGG + Intergenic
903185595 1:21627124-21627146 TCCTCTCCCTGCCCCAGAGGTGG - Intronic
908118401 1:60963301-60963323 TCCTCTGCACACCCCAGGAGAGG + Intronic
915544914 1:156591729-156591751 CGCTCGCCCCGCCCCCGAAGAGG - Intergenic
916069762 1:161163025-161163047 CCCTCTCCACCCCGCCGAGGAGG + Exonic
920002398 1:202808559-202808581 TCCCCGCCCCGCCCCCGAATCGG + Exonic
920038594 1:203081816-203081838 TCCTCTCCAGCCCCTCCAAGGGG + Intergenic
920617632 1:207509191-207509213 TCCTCCCCAGGGCCCCGAAGAGG - Intronic
923622279 1:235588552-235588574 CCCTCTCCACACTCACGAAGGGG + Intronic
923694029 1:236228758-236228780 TCCTCTCCACGCTCCAGATGAGG + Intronic
924679897 1:246220723-246220745 TCCACTCCATGCCCCGGAACTGG - Intronic
1063456361 10:6185458-6185480 CCGTCTCCTCGCCCCCGCAGTGG - Intronic
1066581936 10:36890732-36890754 TCTTCTCCACGCCCCCAAACCGG + Intergenic
1070604662 10:77890341-77890363 TCCTCTCCACTGCCACGATGTGG + Intronic
1075718065 10:124568522-124568544 ACCTCTCCACGCCACCGCGGAGG - Intronic
1078665184 11:13318726-13318748 TCCTCTCCACCCTCCAGATGTGG - Intronic
1081540381 11:44030413-44030435 TATTCTCCAAGCCCCAGAAGGGG + Intergenic
1084001031 11:66295522-66295544 TCCTCTCCACGGCGCCCCAGCGG - Exonic
1091267376 11:134281811-134281833 TCCTCCTCAGGCCCCCGATGGGG + Intronic
1091275137 11:134344820-134344842 TCCTCCTCAGGCCCCCGATGGGG + Intronic
1092881877 12:12893020-12893042 ACCTCTCCACGCCCTTGGAGAGG - Intronic
1096868488 12:54578811-54578833 TCCTCTCCACGTCCCAGAACTGG + Exonic
1100638091 12:96455391-96455413 TCCGCTTCAGGCTCCCGAAGTGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1101519275 12:105466574-105466596 TCCTTTCCACGGTCCCTAAGAGG + Intergenic
1101575475 12:105993257-105993279 TCCTCTCCACAGCCCTGTAGGGG - Intergenic
1104469860 12:129020976-129020998 TCCTCTCTTCACCCCCAAAGAGG + Intergenic
1104744790 12:131204018-131204040 CCCTCTCCAGGCACCCGAGGAGG - Intergenic
1104789622 12:131473400-131473422 CCCTCTCCAGGCACCCGAGGAGG + Intergenic
1111926597 13:94469691-94469713 TCCACTCCACGCCCACAAAAAGG + Intronic
1113809606 13:113130326-113130348 TACCCTCCTCTCCCCCGAAGAGG + Intronic
1113884712 13:113652461-113652483 ACCTCCCCACACCCCCTAAGGGG + Intronic
1118798675 14:69168771-69168793 TCTTCTCCACCCACCCGAACCGG + Intergenic
1122923032 14:104887745-104887767 TCCTGGCCATGCCCCGGAAGCGG + Exonic
1125541141 15:40470916-40470938 CCCTCTCCCCGCCCCCGGCGTGG + Intergenic
1128845556 15:70891866-70891888 TCCTGTACACGCCCCCGAGCTGG - Exonic
1129450450 15:75648330-75648352 CCCTCTCCCCGCCCCAGAAGTGG - Exonic
1129757054 15:78105004-78105026 TGCTCCCCACCCCCCCAAAGAGG - Exonic
1131515619 15:93074353-93074375 TCCTCTCCACACTCCCGACCTGG - Intronic
1132580784 16:683779-683801 TCCCCTCCCCGCCCCCGCAGAGG - Exonic
1132675916 16:1121229-1121251 ACCCCTCCACGCACCCGTAGTGG + Intergenic
1132683396 16:1152879-1152901 CCCCCTCCACGCCCCCGCACTGG - Intergenic
1132789206 16:1675663-1675685 TCCTCTCCACGTCCTCCCAGTGG - Exonic
1138920008 16:61515840-61515862 TCCCCTCCCCGACCCCCAAGGGG - Intergenic
1143503584 17:7352160-7352182 TCCTCTCCGCCCCCAGGAAGTGG - Exonic
1143563516 17:7708625-7708647 TCATCTCCAGGTCCCCGAGGAGG + Exonic
1146339443 17:32007100-32007122 TCCTCTCCGAGCCGCGGAAGGGG + Intergenic
1146944235 17:36863215-36863237 TCCTTTCCATGCCCCAGAAAGGG - Intergenic
1148178237 17:45585459-45585481 TCCTCTCCGAGCCGCGGAAGGGG - Intergenic
1150408137 17:64919749-64919771 TCCTCTCCGAGCCGCGGAAGGGG - Intergenic
1150791739 17:68205184-68205206 TCCTCTCCGAGCCGCGGAAGGGG + Intergenic
1151666811 17:75549850-75549872 TCCTTTCCAGGTCCCGGAAGGGG - Intronic
1152189433 17:78879527-78879549 TCCTGTCCATGCCCCCGAGAGGG + Intronic
1154121258 18:11654354-11654376 TCATCTCCACTCCACCGAAACGG - Intergenic
1156492400 18:37503988-37504010 TCCTCTCCTGGCCCCAGGAGGGG - Intronic
1160688395 19:448274-448296 TCCTCTCCACGTCCCAGAGCCGG + Intronic
1161028313 19:2046689-2046711 TCCTCTCCTCTCCCCTGCAGGGG - Exonic
1161425336 19:4199806-4199828 CCCTCCCCACGCCCCCGACAGGG - Intronic
1162098450 19:8324825-8324847 TCCTCCCCACTCCCCAGACGGGG - Exonic
1162612426 19:11767054-11767076 TCTTCTCCACGCCCCTGCACTGG + Intronic
1163298609 19:16429207-16429229 TCGTCTCCACTCCCCAGCAGTGG + Intronic
1163713590 19:18861367-18861389 TCCTCCCCACACACCCGCAGTGG - Intronic
1163958307 19:20664317-20664339 TCCTCTCCATGCCACCCAACTGG - Intronic
1165163393 19:33832096-33832118 TCCTCTCCTCCCCCACCAAGGGG + Intergenic
1167262816 19:48468711-48468733 ACCACTCCACGACTCCGAAGAGG + Intronic
925939733 2:8805327-8805349 TCCTCTCCCCTCCCCAGAGGTGG + Intronic
927794040 2:26033385-26033407 TCCTCTCCTCGCCCAGGAAGAGG + Intergenic
928243571 2:29607512-29607534 CCCTCACCACTCCCCCGAAATGG + Intronic
930011448 2:46941142-46941164 GCCTCCCCACGCCCCCGCGGGGG + Intronic
932660926 2:73651420-73651442 TCCTCTCCACGGCCCCATATGGG + Intergenic
937083932 2:119158426-119158448 TCCTGGCCGCGCCCCCGACGTGG + Exonic
937246380 2:120496764-120496786 TCCTCTCCAACCCTCCGCAGGGG + Intergenic
942277859 2:174335949-174335971 TCCTCCCCACGCGCCCGCGGAGG - Intronic
943669734 2:190648707-190648729 TCCCCTCCCCGCGCCCGGAGCGG + Intronic
945087359 2:206145730-206145752 TCCTCTCCACCCCCTCAAAATGG + Intronic
1169320227 20:4626274-4626296 CCCTCTCCTGTCCCCCGAAGTGG + Intergenic
1174271801 20:49374795-49374817 TCCTCTCCTCGCCCAAGAAGTGG - Exonic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1176260595 20:64177618-64177640 TCTTGTCCCCGCCCCCGGAGAGG - Intronic
1180997734 22:19973791-19973813 CCCTCTCCCCGCCTCCGCAGTGG - Exonic
1183828766 22:40407146-40407168 CCCACTCCAGGCCCCCGAGGAGG - Intronic
1184470090 22:44691325-44691347 TCCTCTCCGTGCCACCGAGGTGG - Intronic
1184679790 22:46064323-46064345 TCCACTCCAATCCCCCAAAGTGG - Intronic
954448484 3:50559210-50559232 TCCTCTCCCCACCCCAGAGGAGG + Exonic
960359532 3:116694724-116694746 TCATCTCCATGCCCCAGAATAGG + Intronic
960811065 3:121627925-121627947 TCCTCTCCAAGACCCCAATGGGG - Exonic
962367601 3:134796425-134796447 GCCTCTCCACCACCCCGGAGAGG + Intronic
965514319 3:169604623-169604645 TCCTCTCCAAACCCCAGGAGTGG + Intronic
969405920 4:6991678-6991700 TCCACACCAGCCCCCCGAAGGGG - Intronic
969405938 4:6991740-6991762 TCCACACCAGCCCCCCGAAGGGG - Intronic
974035292 4:56812968-56812990 TCCTCTCCACTCTCTGGAAGAGG + Intronic
976565208 4:86545329-86545351 TCCTCTCCCCGCCACGGATGAGG - Intronic
977562563 4:98547215-98547237 TCCTCTCCCCGCCCAGGAAGAGG + Intronic
987123633 5:14791208-14791230 CCCTCTCCAGGCACCCGAAGGGG - Intronic
988218854 5:28315350-28315372 TGCTCTCCACAACCCAGAAGAGG - Intergenic
993727224 5:91381855-91381877 TCCTCACCACCCCCCAGAACTGG + Intronic
1004964531 6:20833407-20833429 TCCTCGCCACTTCCCTGAAGAGG + Intronic
1005987710 6:30884639-30884661 CCCTCGCCCCGCCGCCGAAGAGG + Intronic
1017409882 6:154156867-154156889 TCCTCTTCACAACCCCAAAGAGG + Intronic
1029118819 7:98252570-98252592 TCCTCTCCACGCCCCAGGCCGGG - Intronic
1033211447 7:139463001-139463023 TCCTCTCCTCACACCCGACGCGG + Intronic
1033306866 7:140231347-140231369 TCCTGCCCACCTCCCCGAAGCGG - Intergenic
1035732023 8:1860197-1860219 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732046 8:1860267-1860289 TCCTCTGCATGCCCCGGATGTGG + Intronic
1035732066 8:1860334-1860356 TCCTCTCCATGCCCCCGATGTGG + Intronic
1035732088 8:1860401-1860423 TCCTCTCCATGCCCCCGATGTGG + Intronic
1035732106 8:1860465-1860487 TCCTCTCCATGCCCCTGATGTGG + Intronic
1037593076 8:20329660-20329682 TCCTCTTAACGCCCCCGCAAGGG + Intergenic
1040754142 8:50750147-50750169 ACCTCTCCAAGTCTCCGAAGAGG - Intronic
1044149977 8:88763616-88763638 TCCTCTCCACCCCCCAAAAATGG + Intergenic
1048077176 8:131084308-131084330 TCCTCTACACACTCCAGAAGGGG + Intergenic
1048259919 8:132936742-132936764 TCCTTTCCACCCCACCGGAGAGG - Intronic
1050472611 9:6008201-6008223 TCCTCTCCCCTCCCCGGAGGGGG + Intergenic
1055456501 9:76477236-76477258 ACCACTCCAGGCCCCAGAAGAGG - Intronic
1058553453 9:106140219-106140241 CTCTCCCCACTCCCCCGAAGAGG - Intergenic
1062190862 9:135247177-135247199 TCCTCTCCCCACCCTCCAAGGGG + Intergenic
1190873084 X:54440809-54440831 TCCTCTCCACACCCCCACACAGG - Intronic
1195379233 X:104255284-104255306 TCGTCTCCTCGCCCCCAAATCGG - Intergenic
1201473996 Y:14361517-14361539 TCCTCTCCATGCCCCAGAGCTGG + Intergenic