ID: 1035732412

View in Genome Browser
Species Human (GRCh38)
Location 8:1862280-1862302
Sequence CAGGATCCCCAGGCCTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035732405_1035732412 -4 Left 1035732405 8:1862261-1862283 CCGGGACGTACAGCCCAGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 446
Right 1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG No data
1035732399_1035732412 19 Left 1035732399 8:1862238-1862260 CCGCCTGGCTCTGCAGGGCTTCC 0: 1
1: 0
2: 4
3: 54
4: 440
Right 1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG No data
1035732404_1035732412 -3 Left 1035732404 8:1862260-1862282 CCCGGGACGTACAGCCCAGCCAG 0: 1
1: 0
2: 1
3: 17
4: 136
Right 1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG No data
1035732403_1035732412 -2 Left 1035732403 8:1862259-1862281 CCCCGGGACGTACAGCCCAGCCA 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG No data
1035732400_1035732412 16 Left 1035732400 8:1862241-1862263 CCTGGCTCTGCAGGGCTTCCCCG 0: 1
1: 0
2: 5
3: 35
4: 312
Right 1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035732412 Original CRISPR CAGGATCCCCAGGCCTGCGG TGG Intronic
No off target data available for this crispr