ID: 1035733986

View in Genome Browser
Species Human (GRCh38)
Location 8:1874415-1874437
Sequence ATGCAGCTCCAGCTCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035733984_1035733986 2 Left 1035733984 8:1874390-1874412 CCAACTGCTGTGCGGAATACAGA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1035733986 8:1874415-1874437 ATGCAGCTCCAGCTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035733986 Original CRISPR ATGCAGCTCCAGCTCTCAAA GGG Intronic
No off target data available for this crispr