ID: 1035734794

View in Genome Browser
Species Human (GRCh38)
Location 8:1880334-1880356
Sequence CGTAAGAGGGAGACAGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 438}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035734794_1035734805 15 Left 1035734794 8:1880334-1880356 CCTTTCACTGTCTCCCTCTTACG 0: 1
1: 0
2: 0
3: 19
4: 438
Right 1035734805 8:1880372-1880394 TTCTGGAGGCTCCACAGCTGTGG No data
1035734794_1035734801 -2 Left 1035734794 8:1880334-1880356 CCTTTCACTGTCTCCCTCTTACG 0: 1
1: 0
2: 0
3: 19
4: 438
Right 1035734801 8:1880355-1880377 CGGGGAACCCAGGAACATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 112
1035734794_1035734807 27 Left 1035734794 8:1880334-1880356 CCTTTCACTGTCTCCCTCTTACG 0: 1
1: 0
2: 0
3: 19
4: 438
Right 1035734807 8:1880384-1880406 CACAGCTGTGGCCTCACCGCTGG No data
1035734794_1035734802 1 Left 1035734794 8:1880334-1880356 CCTTTCACTGTCTCCCTCTTACG 0: 1
1: 0
2: 0
3: 19
4: 438
Right 1035734802 8:1880358-1880380 GGAACCCAGGAACATTCTGGAGG 0: 1
1: 0
2: 1
3: 25
4: 197
1035734794_1035734808 30 Left 1035734794 8:1880334-1880356 CCTTTCACTGTCTCCCTCTTACG 0: 1
1: 0
2: 0
3: 19
4: 438
Right 1035734808 8:1880387-1880409 AGCTGTGGCCTCACCGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035734794 Original CRISPR CGTAAGAGGGAGACAGTGAA AGG (reversed) Intronic
900303548 1:1990369-1990391 CGGGAGAGGGAGACAGTGGCGGG + Intronic
900314669 1:2050778-2050800 CGCGAGAGGGAGAGAGGGAAGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902560599 1:17274786-17274808 GGTGAGAGAGAGACAGGGAATGG + Exonic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904484072 1:30813489-30813511 AGAAAGAGTGAGACAGAGAAAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904965485 1:34369426-34369448 AGGAAGAGGGAGAGAGAGAAAGG - Intergenic
905359861 1:37411736-37411758 CGAAAGAGGGAGCAAGTGAGGGG - Intergenic
905655364 1:39683298-39683320 CATGAGAGGGAGAGAGTGATAGG - Intronic
906111183 1:43323106-43323128 AGTAAAAGGTAGACATTGAATGG - Exonic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907716997 1:56935194-56935216 CCTAGGAGGGAGACTGTAAATGG - Intronic
907838568 1:58134644-58134666 AGCAGGAGAGAGACAGTGAAGGG + Intronic
907898413 1:58715062-58715084 GAAAAGAGGGAAACAGTGAAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909280261 1:73742320-73742342 AGAAGGAGGAAGACAGTGAAGGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910338381 1:86157478-86157500 CGTAAGGGGGACAGACTGAAAGG - Intergenic
911293744 1:96088269-96088291 CGTGAGAGGGGCAGAGTGAAGGG - Intergenic
912028374 1:105206761-105206783 CAAGAGAGAGAGACAGTGAATGG + Intergenic
912138012 1:106684831-106684853 AGTAGGAGGAAGAGAGTGAAGGG - Intergenic
912185150 1:107266420-107266442 GGCAGGAGGAAGACAGTGAAGGG + Intronic
912197720 1:107418972-107418994 AATAAGAGGAAGACATTGAAAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914977603 1:152380414-152380436 GATAAGGGGGAGAGAGTGAAAGG - Intergenic
915068925 1:153249527-153249549 AGAAAGAGGGAGACAGAAAAGGG - Intergenic
915265208 1:154711913-154711935 AGGAAGAGAGAGACAGGGAAAGG + Intronic
915265213 1:154711939-154711961 AGGAAGAGAGAGACAGGGAAAGG + Intronic
915265226 1:154712015-154712037 AGGAAGAGAGAGACAGGGAAAGG + Intronic
915527754 1:156486516-156486538 GGTGAGAGGGAGATAGTAAAGGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917363680 1:174204823-174204845 GGAAAGAGAGAGAGAGTGAAGGG - Intronic
919918987 1:202157063-202157085 TGCAAGAGGAAGACAGGGAAAGG + Intronic
920026871 1:203005528-203005550 CGGAAAAGAGAGTCAGTGAAGGG + Intergenic
921545716 1:216472733-216472755 TGTAAGAGTGAGAAAGAGAAAGG - Intergenic
921616316 1:217271948-217271970 GGCAAGAGGGAGCCATTGAAAGG - Intergenic
922329611 1:224562730-224562752 GGCAAGAGAGAGACAGTGAGGGG - Intronic
922334841 1:224610454-224610476 AGAAAGAGAGAGAGAGTGAAAGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923209137 1:231787457-231787479 AGAAAGAGAGAGACAGAGAAGGG + Intronic
924062063 1:240185149-240185171 TGTAGGAGGGAGAAAGAGAAGGG - Intronic
924089025 1:240483941-240483963 AGCAAGAGGAAGGCAGTGAAAGG + Intergenic
924129788 1:240895091-240895113 AGCAAGAGGGAGAGAGTGAGGGG - Intronic
924303344 1:242662101-242662123 CGCAAGAGAGAGACAGAAAAGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063550532 10:7028733-7028755 GGTGAGAGAGAGAGAGTGAAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064273721 10:13887786-13887808 CGTAAGAGAGGAACAGTGATAGG + Intronic
1065233899 10:23626806-23626828 CGCAACAGGGAGAGAGTGGATGG + Intergenic
1067101374 10:43337099-43337121 GGTTAGAGAAAGACAGTGAAAGG - Intergenic
1068120571 10:52779284-52779306 GGGAAGAGGGAGACAGAGATGGG - Intergenic
1068917973 10:62453279-62453301 CATAAGGGTGAGAGAGTGAAAGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069308758 10:67006390-67006412 AGAAAGAGGGAGAAAGAGAAGGG - Intronic
1069517917 10:69094168-69094190 AGTAAGGGGCAGACATTGAAAGG + Intronic
1070376246 10:75833839-75833861 TTTAAAAGGGATACAGTGAAAGG + Intronic
1071308461 10:84321304-84321326 AGCAAGAGAGAGAGAGTGAAGGG - Intergenic
1071371255 10:84953832-84953854 TGTCAGGGGGAGTCAGTGAAAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073684092 10:105733673-105733695 CCGAAGAAGGAGTCAGTGAAGGG - Intergenic
1074902301 10:117829158-117829180 ACTGAGAGGGAGACAGTGAGAGG - Intergenic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1075170734 10:120111428-120111450 AGGGAGAAGGAGACAGTGAATGG - Intergenic
1077272303 11:1686984-1687006 GGGAAGAGGGAGGCAGGGAAGGG - Intergenic
1077615483 11:3670833-3670855 GGGGAAAGGGAGACAGTGAAGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078625380 11:12950989-12951011 GGAAAGAGGGAGGCAGTTAAGGG + Intergenic
1080834106 11:35923949-35923971 CTTAAGATGGAGATAGGGAAAGG + Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1084492958 11:69488308-69488330 GGTAAGAGGGAGACACAGCAAGG + Intergenic
1084849553 11:71928064-71928086 CGTAGGGGTGGGACAGTGAATGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088634031 11:111802079-111802101 GGAGAGTGGGAGACAGTGAAAGG - Intronic
1089049126 11:115530844-115530866 GGTTGGAGGGAGACAGTCAATGG - Intergenic
1090072954 11:123560288-123560310 AGTCAGAGGGAGAGAGAGAAAGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091230130 11:133982809-133982831 GGCAAGAAGAAGACAGTGAAAGG + Intergenic
1091355332 11:134933419-134933441 GGCAAGAGGAAGACAGTGAAAGG - Intergenic
1092061104 12:5551246-5551268 CGTGAGAAGGAGGCAGGGAAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092875315 12:12842607-12842629 GGAAAGAGAGAGACAGAGAAGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095310945 12:40695779-40695801 GATAAGAGGGAGACAAAGAAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096724901 12:53553560-53553582 CTTAAAAGGGGGAGAGTGAAGGG + Intronic
1097008546 12:55936262-55936284 GGGAAGAGGGACACAGGGAAAGG + Intronic
1097520107 12:60656703-60656725 AGCAGGAGGAAGACAGTGAAGGG - Intergenic
1097697324 12:62787197-62787219 CTTAAGCTGGAGACAGGGAAGGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098628730 12:72703562-72703584 CGGAAAAGAGAGTCAGTGAAGGG - Intergenic
1098828162 12:75325871-75325893 GGTAATGGGAAGACAGTGAAGGG + Intronic
1099178185 12:79447165-79447187 AGAAAGAGGGATACAGTCAAAGG - Intronic
1099289393 12:80756995-80757017 AGTAAGAGGGAAACATTGCATGG + Intergenic
1100262012 12:92941336-92941358 AGGAAGAGAGAGAGAGTGAAAGG - Intergenic
1101455428 12:104826008-104826030 GATAAGAGGTAGAGAGTGAAGGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102707077 12:114891399-114891421 AGTAATAGGGAGCCACTGAAGGG + Intergenic
1103420157 12:120774262-120774284 AGTAAGAGGGAGGGAGGGAAAGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103959988 12:124603422-124603444 GGTAAGAGGCAGACGGAGAAGGG - Intergenic
1107103559 13:36619728-36619750 AGCAGGAGAGAGACAGTGAATGG - Intergenic
1107236655 13:38178654-38178676 AGTGAGAGGGAGAGAGGGAAAGG + Intergenic
1108184542 13:47875424-47875446 TGTAAGAGGAAGAGAGTGAAGGG + Intergenic
1108293393 13:48986351-48986373 CTTAAGAGGAAGACAGAGTAAGG + Intronic
1109367905 13:61381584-61381606 TGTAAGAGGGTGGAAGTGAATGG + Intergenic
1109596783 13:64566636-64566658 CGGAACAGGGAAACATTGAAAGG - Intergenic
1110482169 13:75991825-75991847 GGTAAGAGGCACACAGTAAATGG + Intergenic
1110700836 13:78546398-78546420 AGTAATAGGAAGCCAGTGAAGGG + Intergenic
1110897557 13:80773944-80773966 GGAAAAAGGAAGACAGTGAATGG - Intergenic
1112611794 13:100962357-100962379 AGTAAGAGGGATCCATTGAAAGG + Intergenic
1113387289 13:109860467-109860489 TGTTAGAGGGAGGCTGTGAATGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114330207 14:21629152-21629174 CAGGAGAGAGAGACAGTGAAGGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116625558 14:47258384-47258406 AGCAAGAGGAAGAGAGTGAAGGG + Intronic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117169765 14:53081933-53081955 AGGAAGAGGGAGACAGGGAGAGG + Intronic
1117992151 14:61444600-61444622 AGTATGAGGGTGACAGTGTATGG - Intronic
1118463097 14:66004369-66004391 AGGAAGAGGGAGAGAGAGAAAGG - Intronic
1118645786 14:67837934-67837956 GGTTAGAGGGAGACAGCCAAAGG - Intronic
1118963768 14:70560715-70560737 GGCAAGAGAGAGAGAGTGAAGGG - Intergenic
1119537058 14:75411099-75411121 GGTGGAAGGGAGACAGTGAAGGG - Intergenic
1120601097 14:86510773-86510795 CTGAGGAGGGAGACAGGGAATGG + Intergenic
1120873730 14:89360331-89360353 AGAAAGAGGGAGAAAGAGAAAGG + Intronic
1121186626 14:91978028-91978050 CGAGAGAGGGAGAGAGAGAAGGG + Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1124903462 15:33846076-33846098 AGAAAGAGGGAGACAGAGAGAGG - Intronic
1125201471 15:37103865-37103887 TGAAAGAGAGAGACAGAGAAAGG - Intergenic
1125806355 15:42496874-42496896 GGCAGGAGAGAGACAGTGAAGGG + Intronic
1126097590 15:45100415-45100437 AGTAGCAGGGAGACAGTGAGTGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126851435 15:52799280-52799302 AGTAAAAGGGAGAGAGAGAAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128522905 15:68387148-68387170 GATAAGAGGGAGAGAGGGAAGGG + Intronic
1130060073 15:80563389-80563411 CATGGGAGGGAGACAGTGATGGG - Intronic
1130241384 15:82196128-82196150 CAGAAGAAGCAGACAGTGAAGGG + Intronic
1130642332 15:85689911-85689933 CGTAAGAGGAAGCCAGAGACTGG - Intronic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1132340072 15:101072816-101072838 CCGAAAAGGGAGTCAGTGAAGGG - Intronic
1133396781 16:5453802-5453824 CGTACGAGGGTGACAGTGCTAGG + Intergenic
1135733846 16:24915556-24915578 GATAAGAGGGAGAGAGTGCAGGG - Intergenic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1135995258 16:27243243-27243265 CGGAATTGGGAGACGGTGAACGG - Intronic
1136082891 16:27864449-27864471 CTTAGGAGAGAGGCAGTGAAGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137678013 16:50313729-50313751 GGGAAGAGGGAGACAGTGTGGGG + Intronic
1137680370 16:50337904-50337926 AGAAAGAGGGAGAGAGGGAAGGG + Intronic
1137921199 16:52490210-52490232 GGAGAGAGGGAGAGAGTGAAGGG - Intronic
1138509781 16:57501735-57501757 AGTAACAGGGAGCCAGTCAAGGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139342245 16:66275210-66275232 CAAGAGAGAGAGACAGTGAAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139680005 16:68554080-68554102 GAAAAGTGGGAGACAGTGAAGGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140283292 16:73575344-73575366 CGGAACAGGGAGATTGTGAAAGG - Intergenic
1140926493 16:79589443-79589465 AGTAAGAGGGAAAAAGAGAAAGG - Intronic
1141272639 16:82555182-82555204 AGCAGGAGGGAGAGAGTGAATGG + Intergenic
1142097363 16:88249017-88249039 CGTGAGAGGGAGACAGCCAGGGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144042145 17:11421524-11421546 GGTAAAATGGAGACAGCGAATGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146366527 17:32233283-32233305 GGAAAGAGGGAGACATAGAAGGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146542738 17:33711673-33711695 CTGAAGAGAGAGAGAGTGAAGGG + Intronic
1146552525 17:33794053-33794075 GCTAAGAGAGAGACAGTGAATGG + Intronic
1147054736 17:37825538-37825560 AGAAAGAGGGAGACAGGAAATGG + Intergenic
1147122514 17:38343903-38343925 CGTGAGAGGGAGACGGAGAGAGG - Intergenic
1147381515 17:40059078-40059100 CAAAAGAGGGAGCCAGGGAAGGG - Intronic
1147748778 17:42713243-42713265 CTAAAGAAGGAGACAGTGACAGG - Exonic
1148020341 17:44548999-44549021 AGAAAGAGGGAGAAAGAGAAAGG - Intergenic
1151249943 17:72826239-72826261 AGAAAGAGGAAGAGAGTGAAGGG - Intronic
1151305647 17:73261302-73261324 CAGAAGAGAGAGACAGAGAAGGG + Intronic
1151429836 17:74055025-74055047 AGAAAGAGGGAGAGAGAGAAAGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1155060156 18:22221381-22221403 AAAAAGAGAGAGACAGTGAATGG - Intergenic
1155515744 18:26622543-26622565 CTAGTGAGGGAGACAGTGAAAGG + Intronic
1156922120 18:42534509-42534531 AGCAAGAAGGAGACAGTGAAGGG + Intergenic
1156995953 18:43466840-43466862 AGGAGGAGGAAGACAGTGAAGGG + Intergenic
1158268736 18:55688965-55688987 AGAAAGAGGGAGAGAGTGAGAGG - Intergenic
1158991864 18:62876963-62876985 AGAAAGAGGGAAAGAGTGAATGG + Intronic
1159892456 18:73965469-73965491 GGAAAGAGAGAGAGAGTGAAGGG + Intergenic
1161570344 19:5027069-5027091 CGTGAGCGGGAGACAGAGAAAGG + Intronic
1162149015 19:8631733-8631755 CGGAGGAGGCAGAAAGTGAAAGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163977871 19:20869541-20869563 AGTGAGTGGGTGACAGTGAACGG - Intergenic
1163979753 19:20888145-20888167 AATAAGTGGGTGACAGTGAACGG - Intergenic
1163981818 19:20907840-20907862 AGTGAGAGCGTGACAGTGAACGG - Intergenic
1164309989 19:24037156-24037178 CGTGAGTGGGGGACAGTGCATGG - Intronic
1166027336 19:40099636-40099658 TGTAAGAGGGAGAGAGGAAAAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1167099114 19:47393159-47393181 CGGAAAAGAGAGTCAGTGAAGGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925042024 2:739862-739884 CGTCAGAGGGAGGCAGAGATCGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925646068 2:6037931-6037953 CGTAAGAGGGGAACAGGGAAAGG - Intergenic
925776430 2:7340293-7340315 CGTAAGAGGGACCCAGTGGGAGG + Intergenic
927555089 2:24025459-24025481 CTTAGGAGGGCGACTGTGAATGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930305438 2:49669317-49669339 AGTAAGAGGGAGAGAGTAGAGGG + Intergenic
930512704 2:52365988-52366010 CTGAAGAGCAAGACAGTGAAGGG + Intergenic
931812719 2:65870298-65870320 GGAAAGAGGGAGAGAGAGAAAGG - Intergenic
933665248 2:84959577-84959599 CTGAAGAAGGAGACAGTGTATGG - Intergenic
934071219 2:88385351-88385373 CGCAGGAGAGAGACAGTAAAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936001310 2:108832921-108832943 GATAAGAGGGAGACAGGAAATGG + Intronic
936529496 2:113265988-113266010 AGTCAGAGTGAGAGAGTGAAGGG + Intronic
937467531 2:122147789-122147811 CGTAGGAGAGAGAGAGAGAAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938941362 2:136172282-136172304 TGAAAGAGGGAGACAGGAAATGG + Intergenic
939076341 2:137606818-137606840 GGAAAGAGAGAGAAAGTGAAAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941062947 2:160868782-160868804 TGTGAGAGGGAGACCATGAAAGG - Intergenic
941462266 2:165785425-165785447 TGTCAGAGGGCAACAGTGAAAGG + Intronic
943217087 2:185051669-185051691 CAGAAGAGGTAGACAGGGAAAGG - Intergenic
943626599 2:190208290-190208312 CGAAAGAGGGAGAAAGGGTAGGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944038368 2:195325421-195325443 AGAAAGAGGGGGAAAGTGAAGGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946937250 2:224735146-224735168 AGCAAGAGAGAGACAGTGAAAGG - Intergenic
948570459 2:238914225-238914247 CTTAAGAGGGAGACAGAGTGTGG - Intergenic
948704860 2:239783291-239783313 CGTATGAGAGAGAGAGAGAAGGG + Intronic
948964405 2:241365920-241365942 CCTATGAGGGAGGAAGTGAAAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169492969 20:6086732-6086754 CAGGAGAGGGAGAGAGTGAAGGG - Intronic
1169613496 20:7411292-7411314 AGCAGGAGGAAGACAGTGAAGGG - Intergenic
1169878534 20:10323146-10323168 GGGAAGAGGGAGACAGAGATTGG - Intergenic
1170243809 20:14198173-14198195 GGTAAGAGGGAGAGAGAGAGAGG + Intronic
1170370236 20:15640255-15640277 TGAAAGAGTGAGACAGTGAGGGG + Intronic
1170444295 20:16409438-16409460 TGTAAGAGGAAGACACTGAAGGG + Intronic
1171002023 20:21424400-21424422 CAGAAGAGAGAGAGAGTGAAGGG + Intergenic
1171232402 20:23498044-23498066 GGGAAGAGGGAGAGAGGGAAAGG + Intergenic
1172221277 20:33276708-33276730 GGTAAGAGAGAGACAGGGCAGGG + Intronic
1172549995 20:35791376-35791398 CCTAAGAGGTAGACACTAAATGG + Intronic
1173948837 20:46974463-46974485 AGGAAGAGGTAAACAGTGAAGGG + Intronic
1173962964 20:47089275-47089297 CGAAAGAGGGAGACACAGACAGG + Exonic
1175082597 20:56433485-56433507 GGTAATAGGGAGCCACTGAAGGG + Intronic
1175470045 20:59221197-59221219 CAAAGGAGGGAGGCAGTGAATGG + Intronic
1178058895 21:28830352-28830374 AGAAAGAGAGAGAGAGTGAAGGG - Intergenic
1178668858 21:34572847-34572869 AGCAGGAGAGAGACAGTGAAAGG + Intronic
1179025165 21:37673705-37673727 AGTTAGAGGGGGACAGGGAAGGG + Intronic
1179085237 21:38210603-38210625 GGGAAGATGGAGACAGAGAATGG - Intronic
1179384111 21:40925707-40925729 TGTAAGAGGGAGACAGGTGATGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182415383 22:30217937-30217959 GGTGAGAGGGAGACAGGGAGGGG + Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184080764 22:42218337-42218359 TATAAGAGGGTGGCAGTGAAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
949779344 3:7668458-7668480 CGTAAAAGAGAGAGAGAGAAAGG - Intronic
950322202 3:12067079-12067101 CGTGGGAGGGACCCAGTGAAAGG - Intronic
951043869 3:18016592-18016614 CGCAGGAGGAAGAGAGTGAAGGG - Intronic
951272951 3:20649963-20649985 CAGTAGAGGGAGAAAGTGAAGGG - Intergenic
952061880 3:29521055-29521077 GGTAAGAGTGAGAGAGTGACAGG - Intronic
953380505 3:42467904-42467926 AGTAGGAGAGAGAGAGTGAAGGG - Intergenic
953417454 3:42731095-42731117 GGTAAGAGGGAAGCAGTGATGGG - Intronic
953573590 3:44094412-44094434 TGTAAGAGAGAGAGAGAGAAAGG - Intergenic
953620824 3:44531215-44531237 GGAAGGAGGGAGACAGAGAAGGG + Intergenic
953835579 3:46340182-46340204 AGTAGGAGGAAGAGAGTGAAGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954839506 3:53498124-53498146 AGCATGAGGGAGCCAGTGAAGGG + Intronic
957336047 3:78830667-78830689 CGTGGGAGGGAGCCAGTGGAAGG - Intronic
957506615 3:81129431-81129453 AGCAGGAGGGAGAGAGTGAAGGG + Intergenic
957552585 3:81726366-81726388 AGTAAGAGGGAGACAGGAAATGG + Intronic
957772734 3:84715383-84715405 AGGAAGAGAGAGAGAGTGAAGGG - Intergenic
957880007 3:86199961-86199983 CATGAGAGGGACCCAGTGAAAGG + Intergenic
958469269 3:94497567-94497589 AGCAAGAGAGAGAGAGTGAAGGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959578415 3:107960076-107960098 AGTAGGAGGGAGAAAATGAAAGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961656841 3:128447339-128447361 TGGAGGAGGGAGCCAGTGAAGGG - Intergenic
963267196 3:143251310-143251332 AGTAGGAGGGAGAAAGAGAAGGG + Intergenic
963285840 3:143433934-143433956 CTAGAGAGGTAGACAGTGAAAGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964726902 3:159822981-159823003 TGTTAGAGCAAGACAGTGAAAGG + Intronic
965601567 3:170459436-170459458 CGTGAGAGGGAGACAGCGCCAGG + Intronic
965748957 3:171956891-171956913 CTTATGAGGGAGCCAGTGCAGGG + Intergenic
966682336 3:182656021-182656043 TTTAAGAGGGCGAGAGTGAATGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966922820 3:184625247-184625269 TGAAAGAAGGAGACTGTGAACGG - Intronic
967736428 3:192957449-192957471 CACAACAGGGAGACAGTGACAGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970708485 4:18833916-18833938 TGTAAGAAGGTGAAAGTGAAGGG + Intergenic
971068194 4:23059103-23059125 CGTGAGAGGGACACAGTGGGAGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973881799 4:55280436-55280458 CCTAAAAGAGAGTCAGTGAAGGG + Intergenic
974226292 4:59049745-59049767 CATAAGAGCAAGACAGTAAAAGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
977435960 4:96994688-96994710 CCTCAGAGGGAAACAGTTAAGGG - Intergenic
978350168 4:107812871-107812893 CAAAAGAGGGAGAGAGTGAGAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978994916 4:115139063-115139085 TGTAAGAGGGAGACAGAAAAGGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980013138 4:127618929-127618951 GGCAAGAGAGAGAGAGTGAAGGG + Intergenic
980339419 4:131524064-131524086 TGTAAGAGGGAAACAATCAATGG + Intergenic
980982883 4:139669262-139669284 TGTAAGAGGGAGACAGAGAGAGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982510558 4:156276928-156276950 AGGAATAGGGAGACAGTGATAGG + Intergenic
982704730 4:158695168-158695190 CGTAAGCTGGAAACAGTGAATGG + Intronic
983140081 4:164139517-164139539 AGAAAGAGGGAGAAAGAGAAAGG + Intronic
983443730 4:167821603-167821625 AGCAGGAGGAAGACAGTGAAGGG - Intergenic
984512414 4:180694501-180694523 GGTAAGAGGGAGCCAATGGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984818450 4:183859201-183859223 GGGAAGAGGGAGAGAGAGAATGG - Intronic
986273939 5:6257223-6257245 TGTGAGAGGGACCCAGTGAAAGG + Intergenic
987362855 5:17122351-17122373 CCTAAGAGGGAGTGAGAGAAGGG - Intronic
987448910 5:18056835-18056857 AGAGAGAGGGAGACAGAGAAGGG + Intergenic
987925149 5:24331380-24331402 AGAAGGAGGAAGACAGTGAAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990148207 5:52787477-52787499 AGTAAGAGGGAGAGCGAGAAGGG - Intergenic
991057260 5:62334413-62334435 AGGAAGAGGGAGATAGTGAGGGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991435695 5:66596049-66596071 CGTCAGAGGGAGACGGCGAGCGG - Intergenic
991597676 5:68322271-68322293 CTGAAGAGTGGGACAGTGAAGGG - Intergenic
992060726 5:73044069-73044091 AGTAAGAGGAAGAGAGTGAAGGG - Intronic
993332159 5:86614630-86614652 AGGGAGAGGGAGACAGGGAAAGG - Intergenic
993788463 5:92174841-92174863 AGTAAGAGAGAGAGAGGGAAAGG + Intergenic
995558944 5:113360021-113360043 CATAAATGGGAGACTGTGAATGG + Intronic
995821131 5:116234068-116234090 AGGAAGAGGAAGAAAGTGAAAGG + Intronic
995879013 5:116822551-116822573 CCGAAAAGGGAGTCAGTGAAGGG - Intergenic
996239151 5:121172501-121172523 AGGAAGAGAGAGAGAGTGAACGG + Intergenic
999266247 5:150268869-150268891 CTCAAGAGGGAGGCAGAGAAGGG - Intronic
999384192 5:151142752-151142774 CCGAAGGGGAAGACAGTGAAGGG + Intronic
999922803 5:156340995-156341017 CATAAGAAAGAAACAGTGAAGGG - Intronic
1001147619 5:169198580-169198602 AGTAAGAGGGAGCCAGAGAAAGG + Intronic
1003103270 6:3193714-3193736 GGTAGGAGGGCGACACTGAAAGG + Intergenic
1003382332 6:5636617-5636639 CTTCAGAGGGAGGCAGAGAAGGG + Intronic
1004096377 6:12558967-12558989 CCCAAAAGGGAAACAGTGAACGG + Intergenic
1005965350 6:30722676-30722698 GATAAGTGGGAGACAGGGAAGGG - Intronic
1005985717 6:30873417-30873439 GGGAAGAGTGAGACAGGGAAGGG - Intergenic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1008042460 6:46816535-46816557 AGGAAGAGGGAGAGAGGGAAAGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010311612 6:74392738-74392760 CTTAACAGGGAGTCATTGAAGGG - Intergenic
1012192432 6:96297051-96297073 CAGAAGAGGGAGACTGTGAGGGG + Intergenic
1013715947 6:112961754-112961776 CAAGAGAGGGAGATAGTGAAGGG - Intergenic
1014526018 6:122502510-122502532 CAGAAGAGAGAGAGAGTGAAGGG + Intronic
1015269324 6:131323636-131323658 CGGAAAAGAGAGTCAGTGAAGGG - Intergenic
1015564837 6:134558625-134558647 CGTAGGAGGGACACAGTGGAAGG + Intergenic
1015576414 6:134676375-134676397 TGTAAGTGGGAGTGAGTGAATGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020412282 7:7906047-7906069 GTTATGAGGAAGACAGTGAATGG + Intronic
1021101400 7:16588535-16588557 AGTAAGAGAGAGAGAGAGAAAGG + Intergenic
1021332389 7:19354830-19354852 AGCAGGAGGAAGACAGTGAAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024217246 7:47257731-47257753 CGAGAGAGAGAGACAGAGAAAGG - Intergenic
1024225424 7:47322828-47322850 CGTAAGAGGGAATCAGGGAGCGG - Intronic
1025041466 7:55649779-55649801 CCTGAGAGGGGGACAGGGAAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026279591 7:68910211-68910233 CCTGAGAGGGATACAGTGATTGG - Intergenic
1026317805 7:69242246-69242268 AGTAGGAGGGAGAGAGAGAAGGG - Intergenic
1027222397 7:76222482-76222504 GGCAATAGGGAGCCAGTGAAGGG - Intronic
1027784608 7:82565341-82565363 AGTATGAGGGAGAGAGAGAAAGG - Intergenic
1029195110 7:98799943-98799965 AGCAGGAGGGAGACAGTGAGTGG - Intergenic
1030996206 7:116361447-116361469 AGCAGGAGGGAGAGAGTGAAAGG - Intronic
1032515126 7:132501173-132501195 AGAAATAGGGAGACAGAGAAAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033861280 7:145631138-145631160 CATAAGAGAGACACAATGAAAGG + Intergenic
1033885161 7:145934923-145934945 CATAAAAGGGACTCAGTGAAAGG + Intergenic
1034167366 7:149036080-149036102 CAAAAGGGGGAGGCAGTGAAGGG + Intergenic
1034376217 7:150647059-150647081 CAGAAGAGAGAGAGAGTGAAAGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035734794 8:1880334-1880356 CGTAAGAGGGAGACAGTGAAAGG - Intronic
1036005941 8:4663581-4663603 AGCAAGAGGAAGAGAGTGAAGGG - Intronic
1036211494 8:6844591-6844613 CTTACCAGGGAGACAGTGAAAGG - Intergenic
1036281144 8:7402630-7402652 CCAAAAAGGGAGTCAGTGAAGGG - Intergenic
1036340322 8:7908942-7908964 CCAAAAAGGGAGTCAGTGAAGGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036590325 8:10162673-10162695 CTTAAGAGGTAGGCACTGAAGGG + Intronic
1037391238 8:18394032-18394054 CCTAAAAGAGAGTCAGTGAAGGG + Intronic
1037437553 8:18879293-18879315 GATAAGAGGGAGACAGGGCAAGG + Intronic
1038398589 8:27265905-27265927 AGAAAGAGGGAGAGAGAGAAAGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038684198 8:29701441-29701463 CGAGAGAGAGAGAGAGTGAAAGG - Intergenic
1038702319 8:29860154-29860176 GGTAAGAGGAAGTCAGTGATGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042456638 8:69012653-69012675 TGTAAGAAGGAGAGATTGAATGG - Intergenic
1042880341 8:73481143-73481165 ACTCAGAGGGAGAGAGTGAAAGG - Intronic
1043230939 8:77800258-77800280 GGAGAGAGAGAGACAGTGAAGGG + Intergenic
1044307912 8:90658772-90658794 GGTAAGTGGGTGACAGTGATTGG - Intronic
1044539503 8:93393541-93393563 CTTAGGAGGAAGCCAGTGAAGGG + Intergenic
1044597780 8:93975220-93975242 AGTTAGAGGAAGAAAGTGAATGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045649390 8:104328248-104328270 CAGAAGAGGGAGGCATTGAAGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048451076 8:134534571-134534593 AGGAAGAGGGAGAGAGAGAAGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051940529 9:22500608-22500630 AGCAAGAGGAAGAGAGTGAAGGG - Intergenic
1052002344 9:23300383-23300405 AGAGAGAGGGAGACTGTGAAAGG - Intergenic
1052963959 9:34324839-34324861 AGTAAGAGGTAGACAGGTAAAGG - Intronic
1053652021 9:40178408-40178430 AGTAAGAGGGGGACAGAGAAAGG - Intergenic
1053671956 9:40375277-40375299 CAGAAGAGAGAGAGAGTGAAGGG - Intergenic
1053902410 9:42807722-42807744 AGTAAGGGGGGGACAGAGAAAGG - Intergenic
1054383069 9:64515325-64515347 CAGAAGAGAGAGAGAGTGAAGGG - Intergenic
1054512667 9:66001033-66001055 CAGAAGAGAGAGAGAGTGAAGGG + Intergenic
1054532565 9:66197798-66197820 AGTAAGAGGGGGACAGAGAAAGG + Intergenic
1054814887 9:69465576-69465598 GGAAACAGGAAGACAGTGAAAGG + Intronic
1055223715 9:73968959-73968981 GGAGAGAGGGAGAGAGTGAAGGG - Intergenic
1056381391 9:86060276-86060298 GCAAAGAGGGAGACAGAGAAGGG + Intronic
1057838895 9:98469269-98469291 GGAAAGAGAGAGAGAGTGAAGGG + Intronic
1057937396 9:99252374-99252396 GGAAAGAGGGAGAGAGAGAAGGG + Intergenic
1059170089 9:112116689-112116711 GGTAGGACAGAGACAGTGAATGG + Intronic
1060146906 9:121260866-121260888 TGTAAGAAGGAGAAAGTGGAAGG + Intronic
1060422244 9:123477541-123477563 CGTAACATGGACACAGTGAGGGG + Intronic
1061073739 9:128328131-128328153 AGTAGCAGGGAGACAGTGAGTGG + Intronic
1062438626 9:136558602-136558624 CAGGAGAGGGAGACAGCGAAGGG - Intergenic
1203773148 EBV:59481-59503 CATACGAGGAAGACAGGGAAAGG - Intergenic
1185587854 X:1253767-1253789 CGTATGAGGGAAGCAGAGAACGG + Intergenic
1186156265 X:6729818-6729840 CGTAAGAGAGAGAGGGTAAAAGG - Intergenic
1186391200 X:9161306-9161328 GGCAACAGGGAGACAGAGAATGG + Intronic
1187358787 X:18604670-18604692 CGTGAGGTGCAGACAGTGAATGG - Exonic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189406719 X:40732043-40732065 AGTAAGAAGGACAGAGTGAAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190046712 X:47117224-47117246 CGAAAGAGAGAGAGAGAGAAAGG + Intergenic
1190739589 X:53280400-53280422 AGAAAGAGGAAGACAGAGAAAGG + Intronic
1192433113 X:71125881-71125903 AGGAAGAGGGAAACAGGGAAGGG - Intronic
1194170792 X:90578325-90578347 GGTAAGAGAGAGACAGTGGTTGG - Intergenic
1194293136 X:92100328-92100350 CCTAAAAGAGAGTCAGTGAAGGG + Intronic
1195141456 X:101964781-101964803 CCTAAAAGAGAGTCAGTGAAGGG + Intergenic
1196304056 X:114080099-114080121 AGAGAGAGGGAGAGAGTGAAAGG - Intergenic
1197743786 X:129916495-129916517 GCGGAGAGGGAGACAGTGAAGGG - Intronic
1197748284 X:129947655-129947677 CATAATAGGGAGCCAGTGAGGGG - Intergenic
1197762686 X:130038896-130038918 CGTAAGAGAGAGAGAGTAATGGG + Intronic
1197910510 X:131478623-131478645 TGTGAGAGGGAGCCAGTGAGAGG + Intergenic
1199139100 X:144289112-144289134 AGAGAGAGGGAGAGAGTGAAGGG - Intergenic
1199244966 X:145593217-145593239 AGTAAAAGGGAGGCAGAGAAAGG - Intergenic
1199378337 X:147138330-147138352 CCTAAAAGAGAGTCAGTGAAGGG - Intergenic
1200224285 X:154408746-154408768 CGCAACAGAGAGACAGAGAAGGG - Intronic
1200739271 Y:6835460-6835482 AGGAAGTGGGACACAGTGAAAGG + Intergenic
1200803140 Y:7404746-7404768 CGTAAGAGGGACGCAGTGGGAGG + Intergenic
1201629559 Y:16055099-16055121 CATGAGAGGGACACAGTGAGAGG - Intergenic
1201885416 Y:18876372-18876394 TGTGAGATGGAGACAGAGAATGG + Intergenic