ID: 1035734875

View in Genome Browser
Species Human (GRCh38)
Location 8:1880946-1880968
Sequence CCTCACATGCAGCATCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035734865_1035734875 -1 Left 1035734865 8:1880924-1880946 CCCCCTGGGAGCCGCGTTACCCC 0: 1
1: 0
2: 1
3: 4
4: 68
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734868_1035734875 -4 Left 1035734868 8:1880927-1880949 CCTGGGAGCCGCGTTACCCCCTC 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734860_1035734875 14 Left 1035734860 8:1880909-1880931 CCACAGCCACAGCCGCCCCCTGG 0: 1
1: 0
2: 5
3: 63
4: 735
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734863_1035734875 8 Left 1035734863 8:1880915-1880937 CCACAGCCGCCCCCTGGGAGCCG 0: 1
1: 0
2: 1
3: 28
4: 380
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734859_1035734875 24 Left 1035734859 8:1880899-1880921 CCATCAGAAGCCACAGCCACAGC 0: 1
1: 2
2: 19
3: 528
4: 1192
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734864_1035734875 2 Left 1035734864 8:1880921-1880943 CCGCCCCCTGGGAGCCGCGTTAC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734867_1035734875 -3 Left 1035734867 8:1880926-1880948 CCCTGGGAGCCGCGTTACCCCCT 0: 1
1: 0
2: 1
3: 2
4: 50
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data
1035734866_1035734875 -2 Left 1035734866 8:1880925-1880947 CCCCTGGGAGCCGCGTTACCCCC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035734875 Original CRISPR CCTCACATGCAGCATCTGGC TGG Intronic
No off target data available for this crispr