ID: 1035735860

View in Genome Browser
Species Human (GRCh38)
Location 8:1887249-1887271
Sequence TGTTTAGTCCCTCATCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035735860_1035735863 8 Left 1035735860 8:1887249-1887271 CCTAGCAGATGAGGGACTAAACA 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1035735863 8:1887280-1887302 AACAGGAGTGTGAGTGACTCAGG No data
1035735860_1035735864 23 Left 1035735860 8:1887249-1887271 CCTAGCAGATGAGGGACTAAACA 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1035735864 8:1887295-1887317 GACTCAGGACCAGAAGAGTCAGG No data
1035735860_1035735862 -9 Left 1035735860 8:1887249-1887271 CCTAGCAGATGAGGGACTAAACA 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1035735862 8:1887263-1887285 GACTAAACAGGAATCATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035735860 Original CRISPR TGTTTAGTCCCTCATCTGCT AGG (reversed) Intronic
900399368 1:2466735-2466757 TGTTACGTCCCTCAGATGCTGGG + Intronic
904622888 1:31785829-31785851 TGTGTAGTCACAGATCTGCTGGG + Intergenic
904883116 1:33715421-33715443 TGACTAGTCCCTCGTCTGCAAGG + Intronic
907647464 1:56258593-56258615 TGTTTTGCCTCTCATTTGCTTGG + Intergenic
915932934 1:160070928-160070950 TCTTTCCTCCCACATCTGCTAGG - Intergenic
915960060 1:160258852-160258874 TGTTTATTTCCTTATGTGCTGGG - Intronic
916017024 1:160759035-160759057 TATTTAGGCCCTCAACTGATTGG + Intergenic
920452427 1:206069619-206069641 TGAAGAGTCCCTCAGCTGCTAGG - Intronic
921570551 1:216773253-216773275 TGGTGAATCCCTTATCTGCTTGG - Intronic
924227524 1:241934067-241934089 TGTCTAGACCCTCAAATGCTGGG - Intergenic
924747121 1:246846629-246846651 TGTTTAAACCCTCTTCTGTTGGG - Intronic
1064504503 10:16014233-16014255 TGTGTTCTCCCTCATCTCCTTGG + Intergenic
1064599137 10:16975521-16975543 TGTTTCCTCCCTCGTCTGCATGG - Intronic
1068652520 10:59538519-59538541 TGTTTAGAGGCACATCTGCTAGG - Intergenic
1071274270 10:84038570-84038592 TGTTAAGTACCTCATGAGCTGGG + Intergenic
1071687992 10:87782412-87782434 TGTTTAGTGCCACGTTTGCTAGG - Intronic
1072812013 10:98469243-98469265 AGATGATTCCCTCATCTGCTGGG - Intronic
1075431972 10:122392664-122392686 TATTAAGTTCCTTATCTGCTGGG + Intronic
1075538360 10:123290658-123290680 TATTTATTCCCTCATCTCCCTGG - Intergenic
1076119810 10:127926694-127926716 TGTCTAGTTCCTCCCCTGCTAGG - Intronic
1078479016 11:11660008-11660030 TGTTTAGGCCTTCACCTGATTGG - Intergenic
1079331824 11:19540045-19540067 TGTTTACCCCCTCAGTTGCTGGG - Intronic
1079373118 11:19868954-19868976 TGTTTATTCCCTTAGCTGCCAGG - Exonic
1084932055 11:72563955-72563977 TGTTTAGTCTATAATCTGCCTGG + Intergenic
1088329595 11:108636997-108637019 TATTGAGTGCCTCTTCTGCTTGG + Intergenic
1088559020 11:111093476-111093498 TGATTAGACCATAATCTGCTTGG - Intergenic
1091804074 12:3343487-3343509 TGCTTTGAGCCTCATCTGCTTGG - Intergenic
1096435521 12:51587730-51587752 TGTTTAGTTCCTCATCTTGGGGG - Intergenic
1099766483 12:86993493-86993515 TGCATAGTCACTCATCTGCATGG - Intergenic
1106313643 13:28575423-28575445 TGTAAAGTCCCTCATCTGCCCGG - Intergenic
1106444738 13:29817425-29817447 TGCTTAGTCCCTGCTCTACTTGG + Intronic
1106540531 13:30686327-30686349 AGTTTAGTCCCTCAGTTGCCTGG + Intergenic
1106957435 13:34955797-34955819 TGTTTAGGCCTTCAACTGATTGG + Intronic
1107148894 13:37089694-37089716 TGTTTAGGCCTTCAACTGATTGG - Intergenic
1109765231 13:66886616-66886638 TGTATACTCCCTCATTTGCAGGG + Intronic
1115914013 14:38289435-38289457 TGTTTACTCCCTCATTTTCATGG + Intergenic
1117244624 14:53871858-53871880 TGCTTGGACCCTCGTCTGCTTGG - Intergenic
1117942178 14:60980419-60980441 TGTTTAGCCACTTATCAGCTGGG - Intronic
1121072940 14:91041263-91041285 TATTTAGTCTCTCATTTACTGGG + Intronic
1121221038 14:92285548-92285570 GGGTTAGGGCCTCATCTGCTTGG - Intergenic
1122480198 14:102042247-102042269 TGTTTATTGCCTTATCTGCTTGG - Exonic
1123574964 15:21656832-21656854 TTTTTATTCCCTCCCCTGCTTGG - Intergenic
1123611579 15:22099321-22099343 TTTTTATTCCCTCCCCTGCTTGG - Intergenic
1124444479 15:29717760-29717782 TGTTTATTTAATCATCTGCTTGG + Intronic
1125004204 15:34799548-34799570 TGTTTCATCCACCATCTGCTGGG + Intergenic
1129853155 15:78806570-78806592 GGTTTGTTTCCTCATCTGCTTGG + Intronic
1131822452 15:96286616-96286638 TGTTTACTGCTTAATCTGCTGGG - Intergenic
1131972234 15:97904257-97904279 TGCTCAGTGCCTCATCTCCTGGG - Intergenic
1202983832 15_KI270727v1_random:391076-391098 TTTTTATTCCCTCCCCTGCTTGG - Intergenic
1134159567 16:11875914-11875936 TGGTTAGGCCTTAATCTGCTTGG - Exonic
1134405189 16:13951590-13951612 TTTTCAGTCCCTCATGAGCTGGG - Exonic
1137609297 16:49808408-49808430 TATTTATTCCTTCATCTGTTAGG - Intronic
1141339811 16:83192725-83192747 TGTATAGTCCCTCAACTTCCCGG - Intronic
1149246788 17:54718250-54718272 TCTTTCTTCCCTCATCTGATTGG + Intergenic
1151495481 17:74455546-74455568 CTTCTTGTCCCTCATCTGCTTGG - Intergenic
1153465913 18:5387875-5387897 TGTTTAGCCATTCATCTGTTGGG + Intergenic
1157238321 18:45984888-45984910 GGTTCTGTCCCTCATCAGCTAGG + Exonic
1162795228 19:13083616-13083638 TGTTTTGTCCATGGTCTGCTTGG - Intronic
1167506850 19:49875508-49875530 AGTTTCCTCCCTCATCAGCTGGG - Intronic
1168009254 19:53517356-53517378 TGTTTATGTCCTTATCTGCTTGG - Intergenic
928251683 2:29686542-29686564 TCTTGAGTTCCTCATCTGTTAGG - Intronic
929734052 2:44526662-44526684 TGTTTGGGCCCTCAACTGATTGG + Intronic
934541185 2:95176356-95176378 TGTGGAGTCCTTCATCTGCCTGG - Intronic
935950665 2:108325642-108325664 TGTTTATTCCATCAGCTGCTGGG - Intergenic
937468992 2:122159142-122159164 TCTTTCTTCCATCATCTGCTAGG - Intergenic
938199340 2:129360401-129360423 TGTTTACACCCACACCTGCTGGG + Intergenic
941938856 2:171011401-171011423 TATTTATTACTTCATCTGCTTGG - Exonic
944974593 2:205034229-205034251 TGTTGAGTGCCTATTCTGCTAGG + Intronic
946885122 2:224215477-224215499 TTTTCAGTCCCTCAGCTGCTGGG - Intergenic
946888432 2:224248132-224248154 TCTTTGGTCCCTATTCTGCTAGG - Intergenic
948653691 2:239464220-239464242 TGTTTGGACCCTCCTCTCCTGGG + Intergenic
1168915886 20:1486905-1486927 TGTCTAGTTCCTGATCTGCAGGG - Intronic
1169160312 20:3372054-3372076 TGTTTTGTTCCTCATGTGGTAGG - Intronic
1169891915 20:10462722-10462744 TGGTTAGGCCCTCATCTGACTGG - Intronic
1171378817 20:24716537-24716559 TGTTTTATCCCTGATCTTCTAGG + Intergenic
1172031563 20:31985521-31985543 CTTTTAGTCCCTCGACTGCTTGG - Intronic
1172927649 20:38553334-38553356 TGTTTAATTCCTCATCTGTATGG - Intronic
1175839130 20:62015550-62015572 TGTTTAGTTTCTCAGCTCCTTGG - Intronic
1176999854 21:15598828-15598850 TATTTAGTCCTTCAACTGATTGG - Intergenic
1177527571 21:22314391-22314413 TGTTTATTCCATTTTCTGCTGGG + Intergenic
1177917992 21:27114728-27114750 TGCTTTTTCCATCATCTGCTGGG + Intergenic
1178289205 21:31352186-31352208 TGTTTATTCATTCATCTGATGGG - Intronic
1178833209 21:36073540-36073562 TGATAGGTCCCTCATCAGCTCGG - Intronic
1180072017 21:45441354-45441376 TGTGCTGTCCCTCATCTTCTGGG - Intronic
1181515094 22:23405611-23405633 TGTTCCTCCCCTCATCTGCTCGG + Intergenic
1182444769 22:30383601-30383623 TCTTGAGTCCCTACTCTGCTGGG - Intronic
1182803685 22:33052567-33052589 TTTTTTGTTCCTCTTCTGCTAGG - Intronic
1184743052 22:46440170-46440192 TGCTAAGAACCTCATCTGCTCGG + Intronic
956556207 3:70525979-70526001 TGTTTAGACCCTCAGCTGATGGG + Intergenic
959318838 3:104844927-104844949 AGTTTAGTAACTCATCTTCTAGG + Intergenic
959583734 3:108006752-108006774 TGTTTAATCCTTCTTATGCTAGG - Intergenic
960846829 3:122011706-122011728 TGTTCAGTACCTCTTCTCCTGGG - Intronic
962319721 3:134380416-134380438 TGTGTGGTCCCTCATTTCCTGGG + Intergenic
962367088 3:134793928-134793950 TGTCTAGTCTCTCCTTTGCTGGG - Intronic
962977243 3:140456385-140456407 TTTTTAGTTACTCATCTGCGCGG - Intronic
967699638 3:192576706-192576728 AGTTTAGTCCCAAATCTGCTAGG + Intronic
970524082 4:16913784-16913806 TATTAAAACCCTCATCTGCTGGG - Intergenic
970973989 4:22021864-22021886 TGTTTAGTGCCTACTTTGCTGGG - Intergenic
971431893 4:26577030-26577052 TGTTAAGGCCCTCAACTGATTGG - Intronic
972907042 4:43763181-43763203 TGTGTATTCCCTCCTCTGCCTGG - Intergenic
973157852 4:46979415-46979437 TTTATAGTCCATCATCTGATTGG + Intronic
974794610 4:66732224-66732246 TGTTTATGCCCTTATCTGCTAGG + Intergenic
976049920 4:80999348-80999370 AGTTTAGTTTCTCATGTGCTAGG - Intergenic
976822344 4:89220491-89220513 GCTTTAGACCCTCATCTGCTTGG + Intergenic
978098616 4:104809570-104809592 TGTTTAGCCCCTCATTTTTTTGG - Intergenic
978549602 4:109911271-109911293 TGTTGACTCCGTCATCTCCTAGG + Intergenic
978936516 4:114383900-114383922 GATTTAGTCCCTCAGCTGCTGGG + Intergenic
981594032 4:146399017-146399039 TGTTTATTCTCTTATCAGCTAGG - Intronic
981608730 4:146569351-146569373 TATTCAGACCCTCAACTGCTTGG + Intergenic
982054200 4:151531200-151531222 TTTTAAGGCCTTCATCTGCTTGG + Intronic
982138325 4:152294080-152294102 CGTTTAGTCCCTCATTTTATAGG + Intergenic
982405266 4:155012893-155012915 TGTATAATCCCTCATGGGCTGGG + Intergenic
982688638 4:158523625-158523647 TGTTTATGCCCTCATTTCCTGGG - Intronic
983007451 4:162501379-162501401 TGGTTAGACAATCATCTGCTAGG + Intergenic
984294196 4:177832748-177832770 TTTTTATTCCCTCATCTGGCAGG - Intronic
985283268 4:188307885-188307907 TGGGTAGTCCCTGATCTGCAGGG + Intergenic
989405599 5:41057514-41057536 TGTTCAGTGCCTCAGCAGCTTGG + Intronic
990045310 5:51422889-51422911 TGTTATCTCCCTTATCTGCTGGG + Intergenic
990782273 5:59378479-59378501 TGTATAGTCCTCCATCTCCTAGG + Intronic
992613459 5:78527739-78527761 TGTTTAGTCTGTCTTTTGCTGGG - Intronic
993038697 5:82787460-82787482 TGTTTAGCTCCTCAACTGGTTGG - Intergenic
996511269 5:124318838-124318860 TATTCAGGCCCTCAACTGCTTGG + Intergenic
997343544 5:133167073-133167095 TGTTCAGTCTTTCACCTGCTTGG + Intergenic
998297628 5:140986733-140986755 TGTTTAGTCCCAGATCCCCTGGG - Intronic
998415991 5:141946394-141946416 AGTTAAGTCACACATCTGCTAGG + Intronic
999718545 5:154381290-154381312 GCCTTAGTCCCTCATCTGCAAGG - Intronic
1000221057 5:159214809-159214831 TGTTTAGTCCTACCTCTGATTGG - Intergenic
1000339691 5:160267361-160267383 TGCTTTGTCCCTTATCAGCTGGG - Intronic
1001234647 5:170019448-170019470 TGTCTAGTACTTCATCTTCTGGG + Intronic
1005192510 6:23242082-23242104 TGTTTAGTCCCTTTTCTGTGTGG - Intergenic
1005886876 6:30103710-30103732 TGTTTCGGGCCTCGTCTGCTGGG - Exonic
1006913350 6:37578505-37578527 TGTCATGTCCCTCCTCTGCTCGG - Intergenic
1008351187 6:50492320-50492342 TGTTTCCTCCCTCACCTCCTTGG + Intergenic
1009865778 6:69395930-69395952 TGGTAAGTCCCTAATCTGCAGGG - Intergenic
1010993450 6:82505912-82505934 AGTTCAGTCCCACATCTTCTTGG + Intergenic
1011739477 6:90345682-90345704 TGCTCATTCCCTCAGCTGCTGGG + Intergenic
1012415680 6:99010577-99010599 TGTTCACTCCCTCCTCTACTGGG + Intergenic
1014177423 6:118345883-118345905 TGTTTATTCCCCCACCTTCTGGG - Intergenic
1016138502 6:140577923-140577945 AGTTTAGTCCTTACTCTGCTGGG + Intergenic
1017602933 6:156103098-156103120 TGGTTAATCCACCATCTGCTGGG + Intergenic
1018621783 6:165735685-165735707 TGTTCAGGCCTTCATCTGATTGG + Intronic
1024696319 7:51860053-51860075 AGTTCAGTCCTTCCTCTGCTCGG - Intergenic
1024971581 7:55076525-55076547 TTTTTATTCCATCATCTGATAGG + Intronic
1028955829 7:96688813-96688835 TGTTTATTTCATTATCTGCTTGG - Exonic
1029872766 7:103712846-103712868 TGTTTAGTCTCTCAAGTCCTGGG + Intronic
1030186531 7:106767702-106767724 TGTTTATGCCCTTATCTGGTTGG + Intergenic
1030895027 7:115048785-115048807 TGTTAAGTACTTCATTTGCTTGG - Intergenic
1031810369 7:126360503-126360525 TTTATAGTCCTTGATCTGCTGGG + Intergenic
1031870238 7:127083020-127083042 TGTTCAGTCCTTCACCTGATGGG + Intronic
1032489887 7:132316648-132316670 GCTTTAGTTCTTCATCTGCTGGG - Intronic
1032871251 7:135988385-135988407 TCTTCAGTGCCTTATCTGCTGGG - Intergenic
1035735860 8:1887249-1887271 TGTTTAGTCCCTCATCTGCTAGG - Intronic
1038426074 8:27464793-27464815 TTTTGAGCCCCTCATCCGCTAGG + Intronic
1038771265 8:30483017-30483039 GGTTTACTCCCACATCTGCTGGG - Intronic
1039225588 8:35384876-35384898 AGTTTAGTCCCACAACTTCTGGG - Intronic
1039328506 8:36511154-36511176 TGTTTAATCCATAATCTTCTTGG - Intergenic
1039437804 8:37572522-37572544 AGTTCAGACCCTCATCTACTGGG + Intergenic
1039892356 8:41694134-41694156 TGATTAGCCCCTCTCCTGCTTGG - Intronic
1042042603 8:64608975-64608997 TGTTAAGGCCCTACTCTGCTTGG + Intronic
1042356494 8:67834070-67834092 TGCTAAGTCCCTCATCTGAATGG - Intergenic
1046089449 8:109482236-109482258 TGTTTAGCCCCTTATTTACTTGG - Intronic
1046824004 8:118667141-118667163 GGTCTAGTCCCTCTTCTGCAAGG + Intergenic
1047787621 8:128169007-128169029 TGTTTTGTACCTCATCTGCTTGG + Intergenic
1048707025 8:137165221-137165243 GGATTAGTCCCTCAGCTTCTGGG + Intergenic
1050619809 9:7440810-7440832 TGTTTAGGGCCTCCTCTGGTGGG - Intergenic
1058239150 9:102534689-102534711 TGTTTAGGCCTTCAGCTGATTGG - Intergenic
1060332652 9:122687473-122687495 TATTTATTACTTCATCTGCTTGG + Intergenic
1062261483 9:135665237-135665259 TGTTCTGGCCCTCATCTGCGTGG - Exonic
1186702060 X:12101449-12101471 TGTTTAATCCCTCTTCTACATGG + Intergenic
1188549780 X:31350303-31350325 TGTTTACTTCCTCATCTCCCAGG + Intronic
1194116233 X:89901910-89901932 TATTCAGGCCCTCATCTGCTTGG - Intergenic
1195400704 X:104458287-104458309 TATTTAGGCCCTCAACTGATTGG - Intergenic
1199965367 X:152815820-152815842 TGTTTATCCACTCATCTGTTGGG + Intergenic
1200226221 X:154419358-154419380 TGGGAAGTCCCTAATCTGCTGGG + Intronic
1200469033 Y:3559035-3559057 TATTCAGGCCCTCATCTGCTTGG - Intergenic