ID: 1035735864

View in Genome Browser
Species Human (GRCh38)
Location 8:1887295-1887317
Sequence GACTCAGGACCAGAAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035735860_1035735864 23 Left 1035735860 8:1887249-1887271 CCTAGCAGATGAGGGACTAAACA 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1035735864 8:1887295-1887317 GACTCAGGACCAGAAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035735864 Original CRISPR GACTCAGGACCAGAAGAGTC AGG Intronic
No off target data available for this crispr