ID: 1035737252

View in Genome Browser
Species Human (GRCh38)
Location 8:1897937-1897959
Sequence GAGGGGGCTGTGCAGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 683}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035737252_1035737261 6 Left 1035737252 8:1897937-1897959 CCTCTCCACTGCACAGCCCCCTC 0: 1
1: 0
2: 5
3: 77
4: 683
Right 1035737261 8:1897966-1897988 GGGACCTGGAGACTCCCCCCAGG No data
1035737252_1035737256 -8 Left 1035737252 8:1897937-1897959 CCTCTCCACTGCACAGCCCCCTC 0: 1
1: 0
2: 5
3: 77
4: 683
Right 1035737256 8:1897952-1897974 GCCCCCTCAGCAGAGGGACCTGG No data
1035737252_1035737268 29 Left 1035737252 8:1897937-1897959 CCTCTCCACTGCACAGCCCCCTC 0: 1
1: 0
2: 5
3: 77
4: 683
Right 1035737268 8:1897989-1898011 TCAACATTGCCCAACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035737252 Original CRISPR GAGGGGGCTGTGCAGTGGAG AGG (reversed) Intronic
900114178 1:1021438-1021460 GCAGGGGCTGCGCAGTGGACAGG + Intronic
900154015 1:1196903-1196925 GAGGGGGCTGCTCTGAGGAGGGG - Intronic
900406747 1:2496128-2496150 GAGGGGGCTGTGCCCAGGCGAGG - Intronic
900467801 1:2834230-2834252 AAGGGGACTGTGCTGTGGAGTGG + Intergenic
900836706 1:5010441-5010463 GAGGGGGCTGTAGAGTGGATGGG + Intergenic
900979679 1:6039278-6039300 GAGGGGGCAGTGCCTAGGAGTGG + Intronic
902791415 1:18770816-18770838 GAGGGGGTGGTGGAGTTGAGGGG + Intergenic
902804785 1:18854261-18854283 GAGGAGGCTGTGCAGGGCATGGG + Exonic
902977495 1:20099378-20099400 GAGGGGGCGGGGGAGTGGCGGGG + Intergenic
903043868 1:20552096-20552118 GAGGTGGCCGAGCAGTGCAGTGG - Intergenic
903448706 1:23438249-23438271 GAGGGGGCTGTCCAGAAGATGGG - Intronic
903579041 1:24357443-24357465 GTGGGGTCTGGGCAGTGGGGAGG - Exonic
903605516 1:24572616-24572638 GAGGGGGCTGAGCAGTGGGGAGG - Intronic
903621700 1:24702793-24702815 GAGGGGGCTGAGCAGGAGACTGG - Intergenic
903751140 1:25621666-25621688 GAGGCTGCAGTGCAGTGGCGTGG + Intronic
904311162 1:29630410-29630432 TTTGGGGCTGTGCAGTGCAGTGG + Intergenic
904432142 1:30471220-30471242 GAGTGGGCGGGGCCGTGGAGAGG - Intergenic
904473362 1:30749326-30749348 GTGGGGGCGGGGCAGTGGCGAGG + Intronic
904771242 1:32882484-32882506 GAGGGGGCTGGGCAGAAGATGGG + Intergenic
905007118 1:34718688-34718710 GAGGAGCCTGTGGAGTGGGGTGG - Intronic
905011957 1:34753744-34753766 GAGTGGGCTGGGTAGTGGTGGGG - Intronic
905275501 1:36815303-36815325 GTGGGGGCTGGGCAGCGGGGAGG + Intronic
905311844 1:37054581-37054603 GAGGGGGCGGTGTTGTGGAGGGG - Intergenic
905929833 1:41779228-41779250 GAGAGGTGTCTGCAGTGGAGTGG + Intronic
906067711 1:42993992-42994014 GAGCTGGCTCTGCACTGGAGCGG - Intergenic
906318601 1:44803416-44803438 GAGGGGGCAGAGCAGTAGAGCGG + Intronic
907451266 1:54547403-54547425 GTGGGGGGTGGGAAGTGGAGGGG - Intronic
907905459 1:58781046-58781068 GAAGGGGGGTTGCAGTGGAGAGG - Exonic
909721467 1:78775871-78775893 GAAGGGGCTGTGCAGTGGGAAGG + Intergenic
909791649 1:79687045-79687067 GAGGGGGCTATACGGTGGAAGGG - Intergenic
910206653 1:84754923-84754945 GAGCGGGGTGCGGAGTGGAGTGG - Intergenic
911233480 1:95384658-95384680 GAGTGGGCTGTACATTGGAGAGG + Intergenic
911356369 1:96826139-96826161 GAGAGGGCTCTACAGAGGAGGGG - Intergenic
911471824 1:98328377-98328399 GCGGGAGCTGTGCAATGCAGTGG + Intergenic
912466670 1:109879347-109879369 GAGGGGGCTGGGCAGTCCTGGGG + Intergenic
912697773 1:111854520-111854542 GAGTCGGTTGTCCAGTGGAGGGG + Intronic
912927910 1:113929732-113929754 GAAGGGGCTGGGTGGTGGAGCGG + Exonic
912975321 1:114324290-114324312 GAGGAGGCTGTTCAGGGAAGAGG - Intergenic
913529281 1:119722054-119722076 CAGGGGGAAGTGCAGTGCAGGGG - Intronic
913968801 1:143398344-143398366 GAGAGTGCTGAGCAGGGGAGGGG - Intergenic
914063180 1:144223943-144223965 GAGAGTGCTGAGCAGGGGAGGGG - Intergenic
914115970 1:144742411-144742433 GAGAGTGCTGAGCAGGGGAGGGG + Intergenic
914887022 1:151593850-151593872 GAGGGGGCGGGCCAGGGGAGTGG + Intergenic
914902208 1:151716802-151716824 GAGGGGGGTGTGGAGGGGGGAGG - Exonic
915166746 1:153952142-153952164 CAGGGGGGTGGGCAGTGGTGGGG + Exonic
915284050 1:154841786-154841808 GAAGGGGCTGTGCAGGGCTGGGG + Intronic
915462804 1:156080282-156080304 ATGAGGGCTGTGCAGGGGAGTGG + Intronic
915467419 1:156105589-156105611 GCAGGGGCTGTGGACTGGAGTGG + Intronic
915936484 1:160092897-160092919 GAGGGGGCTGGGCCCTGGACGGG - Intronic
916061546 1:161102211-161102233 GAGGGGGATTTGTAGTAGAGTGG - Intronic
916418856 1:164617614-164617636 GAGGGGTGTGTGTGGTGGAGTGG + Intronic
916422682 1:164651244-164651266 GTGGAGGCTGTGCAGGGGAGGGG + Intronic
916422690 1:164651270-164651292 GTGGAGGCTGTGCAGAGGCGGGG + Intronic
917160229 1:172049173-172049195 GAAGGGGCAGTGTAGTGTAGTGG + Intronic
918441308 1:184569844-184569866 GAGGTCACTGTGCTGTGGAGAGG + Intronic
919841362 1:201611503-201611525 GAGGGGGCTGTGTGGTGTGGGGG + Intergenic
919991075 1:202709175-202709197 GAGGGGCCACTGCAGTGGGGAGG - Intronic
920081625 1:203378807-203378829 GAGGGGGCTCTGAAGGGGACAGG - Intergenic
920255621 1:204652245-204652267 GGGGGGGCGGTGAAGAGGAGAGG - Intronic
920309222 1:205038855-205038877 GAGGGGTCTGTGGCCTGGAGGGG - Intergenic
920342649 1:205285019-205285041 CAGAGGGTTGTGAAGTGGAGAGG + Intergenic
920385955 1:205570042-205570064 GAGGTGGGTGGGGAGTGGAGGGG - Intronic
920399797 1:205669735-205669757 GGGGTGGCTGTGAAGGGGAGAGG - Intronic
920499015 1:206474625-206474647 GTGGGGGCGGTGCACTGGAAAGG + Intronic
920665445 1:207959639-207959661 GAGGGGGCAGTGCGGTGGGAGGG - Intergenic
921070738 1:211655805-211655827 TAGGGGGCTGGGGAGGGGAGCGG - Intergenic
921180946 1:212630716-212630738 AAGGAGGCTTTGCAGAGGAGGGG + Intergenic
922203397 1:223426008-223426030 GAGGAGGATGTGCTATGGAGCGG - Intergenic
922339656 1:224645230-224645252 GAGGGGGCAGAGCAGGGCAGTGG - Intronic
922419140 1:225447698-225447720 CTGCAGGCTGTGCAGTGGAGTGG - Intergenic
922463262 1:225828931-225828953 GGCCGGGCTGGGCAGTGGAGAGG + Intronic
922717860 1:227886489-227886511 GGGGAGGCTGGGCAGGGGAGAGG - Intergenic
922757678 1:228105555-228105577 GAGGAGGCTGGGTAGTGGAGGGG + Intergenic
922872581 1:228915440-228915462 GGGTGGGCAGTGCAGTGGGGTGG - Intergenic
923022260 1:230174307-230174329 GAGGTGTCAGTGCAGGGGAGAGG - Intronic
923510765 1:234650493-234650515 GAGTAGGCTGAGCAGTGGGGAGG + Intergenic
924626444 1:245699809-245699831 GTTGGGGCAGTGCAGGGGAGGGG - Intronic
924651626 1:245933929-245933951 GAGGGGGCTGGGAAGTGGCTGGG - Intronic
1062760428 10:12965-12987 GTGGGCGCTGTGCAGTGGGCTGG - Intergenic
1062927361 10:1327065-1327087 GGAGGCGCTGTGCAGTGGGGAGG - Intronic
1062927420 10:1327386-1327408 GGAGGCGCTGTGCAGTGGGGAGG - Intronic
1062928950 10:1339958-1339980 GCTGGGGGTGGGCAGTGGAGAGG + Intronic
1063121316 10:3106917-3106939 GAAGGGGCAGTGCAGGGGAGAGG - Intronic
1063253873 10:4304827-4304849 GATGGGGCTTTGCAGAGGAAAGG - Intergenic
1063441314 10:6075605-6075627 GAGGGGACTGTGGGGTGGAGGGG - Intergenic
1063441321 10:6075622-6075644 GAGGAGACTGTGGGGTGGAGGGG - Intergenic
1063441352 10:6075707-6075729 GAGGGGACTGGGGGGTGGAGGGG - Intergenic
1063441361 10:6075724-6075746 AAGGGGACTGTGGGGTGGAGGGG - Intergenic
1063661531 10:8037611-8037633 GAGGGGAAGGCGCAGTGGAGGGG - Intergenic
1063713629 10:8505693-8505715 GAGGGGACTGTTCAGGGGACTGG + Intergenic
1065166661 10:22986096-22986118 GGGGGGGGCGTGCAGTGCAGGGG - Intronic
1067092220 10:43273662-43273684 GAGGGGCCTGTGCAAGGGGGCGG + Intergenic
1069690494 10:70348623-70348645 AAGGGGGCAGTAGAGTGGAGTGG - Intronic
1070662600 10:78318153-78318175 GGGGAGGCTGGGCATTGGAGGGG + Intergenic
1070751248 10:78965269-78965291 GAGAGGGCTGTGGAGGTGAGAGG + Intergenic
1070801166 10:79245170-79245192 GGGAGGGCTGTGCAGGGCAGTGG - Intronic
1071551442 10:86569210-86569232 GAGCGGGCTGTGCAGGAGACTGG + Intergenic
1071603520 10:86970344-86970366 CAGAGGGCTCTGCAGAGGAGAGG - Intronic
1072553161 10:96494305-96494327 GAGGTGGCAGCGGAGTGGAGGGG - Intronic
1073054241 10:100688922-100688944 GTGGGGGCTGTTTAGAGGAGGGG - Intergenic
1073099251 10:100998353-100998375 GAGGGGGCTCTGCTGGGGAGAGG + Intronic
1073140405 10:101243436-101243458 GATGAGGCTGGGCAGGGGAGGGG + Intergenic
1073992768 10:109282297-109282319 GATGAGGCAGAGCAGTGGAGAGG - Intergenic
1074037332 10:109753570-109753592 GAGGTGGCAGGGGAGTGGAGTGG + Intergenic
1075355414 10:121768461-121768483 GGAGGGGCTGGGCAGGGGAGGGG + Intronic
1075566979 10:123512061-123512083 GGGGGAACTGTGCAGGGGAGGGG + Intergenic
1075615910 10:123891096-123891118 GAGGGAGCTGTGCAATTGGGAGG - Intronic
1075782460 10:125026242-125026264 GTGAGGGCTGGGCAGCGGAGAGG + Exonic
1076058180 10:127392403-127392425 GAGGGAGCTGTGCCGTGGCCTGG + Intronic
1076142659 10:128091964-128091986 AAGCGGGCTGTACAGAGGAGGGG + Intergenic
1076372025 10:129961570-129961592 GAGGGGGCAGAGCAGTGGACGGG + Intronic
1076398242 10:130157360-130157382 GATGGGGGTGTGCGGAGGAGAGG + Intronic
1076524029 10:131099642-131099664 GAAGGGGCTGAGCAGTGCTGGGG - Intronic
1076710047 10:132328119-132328141 GAGCGGGCTGTGCAGGAGACCGG + Intronic
1076786516 10:132752423-132752445 GAGGGGCGTGTGATGTGGAGGGG + Intronic
1076786522 10:132752440-132752462 GAGGGGGCTGTGGCGTGGAGGGG + Intronic
1076786527 10:132752457-132752479 GAGGGGGGTGTGGCATGGAGAGG + Intronic
1076844887 10:133065266-133065288 GAGGGGGAAGAGCAGAGGAGTGG - Intergenic
1077226495 11:1441102-1441124 GAGGGGACAGTGCACTTGAGGGG - Intronic
1077423232 11:2462704-2462726 GAGGGGGCGGTGGAGTGAAGGGG + Intronic
1077536766 11:3128301-3128323 GAGGGGGCAGAGCTGGGGAGAGG + Intronic
1078210224 11:9264802-9264824 AAGGGGGCTTTGGACTGGAGGGG - Intronic
1078518761 11:12047100-12047122 GAAAGGACTTTGCAGTGGAGGGG - Intergenic
1078639204 11:13079621-13079643 CATGGGGATCTGCAGTGGAGAGG - Intergenic
1079324123 11:19476948-19476970 GAGGGGGCCATGAAGAGGAGAGG - Intronic
1079373809 11:19873852-19873874 CAGAGGGCTGTTGAGTGGAGGGG + Intronic
1080321878 11:31019493-31019515 GGGGAGGTGGTGCAGTGGAGAGG + Intronic
1081540340 11:44030280-44030302 GAAGGGGCTTTGTAGTGAAGGGG - Intergenic
1081541584 11:44038499-44038521 GACAGGGCTTTCCAGTGGAGAGG + Intergenic
1081872104 11:46387928-46387950 GAGTGGACTGTGGAGGGGAGAGG - Intergenic
1081958135 11:47111550-47111572 GAGTGGGGTGTGGAGTGGGGTGG - Intronic
1082814650 11:57499888-57499910 GAAGGGGCTGCGCAGAGGGGCGG + Intronic
1082849862 11:57754904-57754926 GAGGGGGCAGAGGAGGGGAGGGG - Intronic
1083144903 11:60750835-60750857 GAGAGGGCTGTGCATATGAGGGG + Intergenic
1083149960 11:60785702-60785724 GATGGGGCTCCGCAGGGGAGAGG - Intronic
1083349980 11:62020788-62020810 GAGGAGGCTGCATAGTGGAGTGG + Intergenic
1083352769 11:62042696-62042718 GAGGGGGCAGAGGAGTGGATTGG + Intergenic
1083802919 11:65057310-65057332 GAAGGGGCTGGGCAGTGGACTGG - Intronic
1083844385 11:65322305-65322327 GAGGTGGCTGAGCACTGGGGTGG + Exonic
1083944642 11:65917191-65917213 CATGGTGCTGGGCAGTGGAGAGG + Exonic
1084193408 11:67509195-67509217 GAGGGGTCTGAGTGGTGGAGTGG - Intergenic
1084429286 11:69102328-69102350 GAAGGGGCTGTGCAGTGCGGGGG - Intergenic
1084501120 11:69536072-69536094 GAGGGGCCTGGGCCGAGGAGGGG - Intergenic
1084708863 11:70831550-70831572 GAGGGGGTGGTGCAGTGTATGGG - Intronic
1085414496 11:76311147-76311169 GAGGCAGCTGAGCACTGGAGAGG - Intergenic
1085619001 11:78023223-78023245 GGCAGGGCTGCGCAGTGGAGCGG - Exonic
1085793085 11:79512899-79512921 GTGGGGGCAGTGCAGAGGGGTGG + Intergenic
1086930671 11:92689589-92689611 GAGGGCTCTGTGCAGTTGGGAGG + Intronic
1087061226 11:93979777-93979799 GTGTGGGCTGTGCAGAGGTGTGG + Intergenic
1088781326 11:113136748-113136770 CAGGAGGCTGGGCTGTGGAGAGG + Intronic
1089045396 11:115497813-115497835 GAGGGGGCGGTGCAGGGGGCAGG + Intronic
1089064466 11:115652113-115652135 GTGAGGGCTGTGTAGAGGAGGGG + Intergenic
1089419758 11:118322709-118322731 GAGGCGACTGTACGGTGGAGAGG - Intergenic
1089671919 11:120062662-120062684 GAGGTCGCTGTGCACTGCAGTGG + Intergenic
1090307322 11:125702587-125702609 GAGGTAGCTGGGCAGTGAAGTGG - Intergenic
1090377793 11:126303794-126303816 GAGGTGGCTGCGCAGTGAAGAGG - Exonic
1090846816 11:130536443-130536465 GAGGAGGCTGTGGGCTGGAGCGG + Intergenic
1091263620 11:134253592-134253614 GCGGCGGCTATGCTGTGGAGCGG + Exonic
1091400931 12:180150-180172 CTGGGGGCTATGCAGTGAAGGGG + Intergenic
1091561797 12:1620197-1620219 GAGGGGGCTGTGATGAGGAAGGG - Intronic
1091864533 12:3820016-3820038 GTAGGGGATGTGGAGTGGAGTGG - Intronic
1092339443 12:7662874-7662896 GAGGGAGATGAGCAATGGAGGGG + Intronic
1092462496 12:8698396-8698418 GCGGGGGCTGGGCCGGGGAGGGG + Intronic
1093545546 12:20342171-20342193 GAGGTGGCTGTGCAATGGCAGGG - Intergenic
1094082106 12:26548355-26548377 GATGGGGGTGTGAAGTGGAGAGG + Intronic
1094555722 12:31497860-31497882 GAGGGGGAGGGGCAGTGGAGGGG + Intronic
1095858477 12:46888297-46888319 GTGGGGGCTGTGCAGGAGGGAGG + Intergenic
1095984679 12:47991447-47991469 AAGGGGGCTGTGCAGTGTCCGGG - Intronic
1096031599 12:48421035-48421057 GAGGTGCCTGTGGAGAGGAGAGG - Intergenic
1097147723 12:56953306-56953328 GAGGGGACTGAGGACTGGAGAGG - Intronic
1097158374 12:57028750-57028772 GAGGTGACTGTGCAGTGAGGAGG - Exonic
1097322835 12:58245268-58245290 GAGGGTGTTCTGCAGTGGGGAGG - Intergenic
1097980059 12:65729216-65729238 GAGGGAGCGGTGCAGAGGACCGG - Intergenic
1101067535 12:101038390-101038412 GAAGCGTCTGTGCAGGGGAGTGG + Intronic
1101311775 12:103587132-103587154 GAGGGGGCAGAGTAGAGGAGAGG + Intergenic
1101396801 12:104355883-104355905 GAGGGCTCTGAGCAGAGGAGGGG + Intergenic
1102188099 12:110965391-110965413 GGGGGGGGTGTGGAGGGGAGTGG - Intergenic
1102236228 12:111296255-111296277 GAGAGGGATGTGCAGTGGCTGGG - Intronic
1102420350 12:112798624-112798646 GAGGAAGATGTGCAATGGAGCGG - Intronic
1102598640 12:114012598-114012620 GAGGGGGTGGGGCAGTGGATAGG + Intergenic
1102720669 12:115013444-115013466 AAGGGGGCTTTGCAGCGGGGAGG - Intergenic
1102720714 12:115013730-115013752 GAGGGGGCCATGCGGGGGAGAGG - Intergenic
1102853799 12:116277017-116277039 GAGGGGGCTGTGCCGGGGAAGGG - Intronic
1103185398 12:118952671-118952693 GAGGCAGCGGTGGAGTGGAGCGG - Intergenic
1103533727 12:121620456-121620478 GAGGGGGCTTTGGGGTGGTGAGG - Intergenic
1103948707 12:124540632-124540654 GAGGGGGGTGGGGAGTGGACTGG + Intronic
1103948765 12:124540775-124540797 GAGGGGGATGGGAGGTGGAGGGG + Intronic
1103980833 12:124736141-124736163 GGGAGGGCTGGGCAGTGGGGTGG - Intergenic
1104586349 12:130051071-130051093 GAAGGGGCTGTGGAGGGGAGGGG - Intergenic
1104893567 12:132151468-132151490 GAGGTGGCTGGGCAGGGCAGTGG - Exonic
1104983724 12:132585366-132585388 GAGGGGGCTGGGCAGAGCCGGGG - Intergenic
1105295664 13:19086307-19086329 GTGGGGGCTGAGAAATGGAGTGG - Intergenic
1105705301 13:22964540-22964562 GAGGTGGCACTGCAGGGGAGAGG + Intergenic
1106096198 13:26646502-26646524 GTGGGGGGTGAGCAGTGAAGTGG - Intronic
1106289136 13:28344307-28344329 TAGGAGGCTGGGCAGGGGAGGGG - Intronic
1107557486 13:41529890-41529912 GATGGGGCTGGGGAGTGGGGTGG + Intergenic
1109179967 13:59202071-59202093 GAAGGGCATGTGCAGTGGAGGGG - Intergenic
1112507653 13:99984856-99984878 GAGGGGGCTGGGCCGCGGCGAGG - Intronic
1113263597 13:108592568-108592590 GTGGAGGCTGTGGAGTGGAGTGG + Intergenic
1114083144 14:19218828-19218850 CGAGGGGCTGTGCAGTGGGGAGG + Intergenic
1114275776 14:21142741-21142763 GGGGGGGGGGAGCAGTGGAGAGG + Intergenic
1114650083 14:24279265-24279287 GTGGGGAATGGGCAGTGGAGAGG - Intergenic
1116388131 14:44358268-44358290 TAGGGGACTGTGCAGTGAAATGG + Intergenic
1116987710 14:51239090-51239112 GAGAGGGCTATTCAGTGGAGGGG + Intergenic
1117073888 14:52081446-52081468 CAGGGTGCTGTTCTGTGGAGTGG + Intergenic
1117243784 14:53862737-53862759 GAGTGGGCTAGGCAGTGGAGAGG + Intergenic
1117733508 14:58747131-58747153 GATGGGGATGAGCAGTGGGGAGG + Intergenic
1117733523 14:58747190-58747212 GATGGGGATGAGCAGTGGGGAGG + Intergenic
1119430843 14:74567252-74567274 GAGGGGGCTGGAGGGTGGAGGGG - Intronic
1119804622 14:77474882-77474904 GAGGGGGCTGAGCAAAGGAAAGG + Exonic
1119983738 14:79112247-79112269 GAGGGGGCTGGGAAGAAGAGAGG - Intronic
1120526148 14:85579165-85579187 GTGGGAGCTGTGCAGTGGGCTGG + Intronic
1120996312 14:90421039-90421061 CATGGAGCTGTGCAGTGGACAGG - Intergenic
1121335675 14:93076324-93076346 GAGGGGGGTGTGCATGGCAGTGG - Intronic
1121472514 14:94166216-94166238 GAGGGGGCGGTGCGGGGGCGGGG - Intronic
1122044087 14:99011117-99011139 GAGGGGTCTCTGCATTGGTGGGG + Intergenic
1122284023 14:100640223-100640245 GAAGGGGCTCTGCAGGGCAGAGG - Intergenic
1122291980 14:100685728-100685750 GAGGGGGCTGTGGTGGAGAGGGG - Intergenic
1122292229 14:100686387-100686409 GAGGGGGCTGTGGTGGAGAGGGG - Intergenic
1122292309 14:100686601-100686623 GAGGGGGCTGTGGTGGAGAGGGG - Intergenic
1122292317 14:100686620-100686642 GAGGGGGGGCTGCGGTGGAGAGG - Intergenic
1122372672 14:101237284-101237306 GATGGGGCTGGCCGGTGGAGAGG - Intergenic
1122414377 14:101541863-101541885 GAGGGGGCTGGCCTGGGGAGGGG - Intergenic
1122644971 14:103188130-103188152 GTGGGGGCTGGGCTGGGGAGAGG + Intergenic
1122984016 14:105203892-105203914 CAGGGGCCTGGGCAGTGGGGGGG + Intergenic
1123040513 14:105488411-105488433 GAGGAGGCTGTGGGGTGGGGTGG - Intronic
1202894767 14_GL000194v1_random:596-618 CAAGGGGCTGTGCAGTGGGGAGG + Intergenic
1124368069 15:29088047-29088069 GAGGGGGCTGAGAGGTGCAGGGG - Intronic
1124632920 15:31347471-31347493 CAGGGGGCTGGGCTGGGGAGGGG + Intronic
1125603143 15:40926341-40926363 GAGGGGGTTGGGGAGAGGAGAGG + Intergenic
1125736070 15:41926754-41926776 GTGTGGTTTGTGCAGTGGAGAGG - Intronic
1126837073 15:52678764-52678786 GAAGGGGTTGTGCAGAGCAGGGG - Intronic
1127277735 15:57461953-57461975 GAAGGGGATTTGCAGTGGTGTGG - Intronic
1128264358 15:66253882-66253904 GAGGGGGGTGTGCGGGAGAGCGG - Intergenic
1128272805 15:66326378-66326400 GAGGGGGCAGAGGAATGGAGTGG + Intronic
1129341702 15:74890479-74890501 GTGGGGCCTGAGGAGTGGAGTGG + Intronic
1129608097 15:77034589-77034611 GTGGGGTTTGTGGAGTGGAGTGG - Intronic
1129675886 15:77632385-77632407 GAGGGGGCTGGGCAGGGGCTGGG - Exonic
1129904466 15:79176419-79176441 GAGGAGGCTGTGCTTTGGAAAGG + Intergenic
1129922166 15:79328772-79328794 GAGGGGTCTGTGGAGAGGGGTGG + Intronic
1129933620 15:79431949-79431971 GAGGGGGCGGTCCCGGGGAGGGG - Intergenic
1130998745 15:88921235-88921257 GAGCTGGCTGTGCAGGAGAGCGG - Intergenic
1131271992 15:90953199-90953221 GCTGGTGCTGTACAGTGGAGAGG + Exonic
1132031361 15:98440875-98440897 GAGGGGGGTGTTGCGTGGAGAGG - Intronic
1132551948 16:557176-557198 GAGGGGGCTGGGCAACCGAGTGG - Intergenic
1132731915 16:1366927-1366949 CAGGGGGCTGTGCTGGGGTGGGG + Intronic
1132886101 16:2182766-2182788 GAGGTGCCTGTGCAGTGGGATGG - Intronic
1132913361 16:2327511-2327533 GAGAGAGCTGTGCAGGGAAGGGG + Intronic
1133286146 16:4691820-4691842 GCGGGGGCTGTGCAGAGGCCTGG - Intergenic
1133757920 16:8776498-8776520 GTGGGGGCGGGGCAGGGGAGGGG - Intronic
1133814906 16:9189604-9189626 CTGGGGCCTGTGCAGGGGAGGGG - Intergenic
1134025002 16:10946587-10946609 GAGGTGGCTGAGGAGGGGAGGGG + Intronic
1134148120 16:11783984-11784006 GGGGGGGCTGTGAGGTGGGGAGG + Intronic
1134625582 16:15720394-15720416 AAGGGGGCTGTGCTGGGGAAGGG - Intronic
1135631020 16:24035623-24035645 GGTGGGGCAGTCCAGTGGAGGGG + Intronic
1135830166 16:25765848-25765870 GAGGGGGCTGTGCTGGGAGGGGG + Intronic
1136009587 16:27354772-27354794 GAGAGGGCTGTGCGGTGGCAGGG - Intronic
1136073664 16:27804180-27804202 GAGTTCGCTATGCAGTGGAGGGG - Intronic
1137567634 16:49543391-49543413 GTGGGGGCTGTGGTGGGGAGTGG - Intronic
1138514243 16:57527150-57527172 GAGGGGGCTGGGCAGAATAGAGG + Intronic
1139363635 16:66419316-66419338 GAGGGGGGTGTGGAGAGGAGGGG + Intergenic
1139656219 16:68388611-68388633 GAGGGGGCTGTGCAGCTGGTGGG - Intronic
1140033507 16:71356541-71356563 TGGGGGGCTGTGCAGCGCAGTGG + Intergenic
1140034144 16:71359991-71360013 TGGGGGGCTGTGCAGTGCAGTGG - Intronic
1140070881 16:71648844-71648866 GAGGAGGCTGTGCAGGGTTGGGG - Exonic
1140334123 16:74087962-74087984 GAAAGGGCTGTGCAATTGAGGGG - Intergenic
1140568725 16:76076277-76076299 AAGGAGGCTGTGCAGTGTAGAGG - Intergenic
1141409050 16:83820253-83820275 GAGGAGGCTGTGCCGTGGATAGG + Intergenic
1141679723 16:85537013-85537035 GAGTGGGCTGGGCAGTGGTCAGG + Intergenic
1142592623 17:1012971-1012993 GAGGGGGCTGGGCTGCGGGGAGG + Intronic
1142748392 17:1972533-1972555 GAGAGGGCGTTGCAGGGGAGGGG - Intronic
1143548649 17:7615084-7615106 GGGGTGGCTGGGCGGTGGAGCGG - Intronic
1144750848 17:17647123-17647145 GAAGGGGATGTGCAGGGGAGGGG + Intergenic
1144802254 17:17937794-17937816 GAGAGAGCTGCACAGTGGAGGGG + Intronic
1145282397 17:21477649-21477671 CAAGGGGCTGTGCAGGGGGGAGG - Intergenic
1145395074 17:22488106-22488128 CAAGGGGCTGTGCAGGGGAGAGG + Intergenic
1146178108 17:30679596-30679618 GAGGGGGGTGGACAGAGGAGGGG + Intergenic
1146269664 17:31476701-31476723 GAGAGGCCAGTGCAGTGGGGAGG - Intronic
1146489620 17:33271039-33271061 CAGGAGGCTGTGCAGTGTAGAGG - Intronic
1146507460 17:33417701-33417723 GAGGGGAATGTGCAGAGGGGCGG - Intronic
1146625612 17:34432799-34432821 GAGGTGGGTGTGAAGAGGAGGGG - Intergenic
1146655273 17:34631296-34631318 AAGGGGGTGATGCAGTGGAGCGG - Intronic
1147159404 17:38561678-38561700 GTAGGGGCTGTGCGGTGGCGGGG + Exonic
1147165848 17:38592939-38592961 GTGGGGGCTGTGGTGAGGAGAGG - Intronic
1147324138 17:39662368-39662390 GTGGGTTCTGTGGAGTGGAGGGG + Intronic
1147333951 17:39715800-39715822 GAGGGAACTGGGCAGTGGACTGG + Exonic
1147365745 17:39957950-39957972 TAGGGGGATTGGCAGTGGAGGGG + Intergenic
1147387057 17:40089005-40089027 GAGGCAGCTGGGAAGTGGAGAGG - Intronic
1147995657 17:44359000-44359022 GAGCAGGCAGGGCAGTGGAGTGG - Intronic
1148148880 17:45384426-45384448 GAGTGAGCTGAGCAGAGGAGAGG + Intergenic
1148325096 17:46778786-46778808 CCGGGGGCCGGGCAGTGGAGAGG - Intronic
1148736941 17:49870192-49870214 GTGGGAGCTGAGGAGTGGAGGGG + Intergenic
1148739471 17:49884429-49884451 GACTGGGCCATGCAGTGGAGTGG + Intergenic
1148753939 17:49962766-49962788 GGGAGGGGTGTGCAGGGGAGGGG + Intergenic
1148790107 17:50168086-50168108 GAGGGGGCTGTGGACAGGAGAGG + Intronic
1148858251 17:50590846-50590868 GAGGGGCCTGGGCAATGAAGAGG - Intronic
1148865925 17:50628573-50628595 GAGGGGGCTGTTCAAGGGAGTGG - Intergenic
1149127590 17:53254544-53254566 GGGGAGGCTGTGCTGTGGGGAGG - Intergenic
1150105011 17:62456231-62456253 GGGGTGTCTGTGCAGTGGTGGGG - Intergenic
1150229170 17:63540656-63540678 GAGGGGGCTGAGGCCTGGAGAGG - Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1150494164 17:65594463-65594485 GTGCGGGCTGCGCGGTGGAGGGG - Intronic
1150624063 17:66830192-66830214 TAGTGGGCTGTGGAGAGGAGAGG + Intergenic
1151210766 17:72542301-72542323 GGGAGGGCTGTGTAGGGGAGGGG + Intergenic
1151216242 17:72578565-72578587 GTGGGGGCAGAGCAGAGGAGAGG - Intergenic
1151273365 17:73014092-73014114 GAGTGGGCTCTGCAGAGGATGGG - Intronic
1151322453 17:73360056-73360078 GAGAGGGCTGTGCGGAGGACAGG - Intronic
1151428991 17:74050040-74050062 CAGGGGGCAGCACAGTGGAGAGG - Intergenic
1152083955 17:78205901-78205923 GAGGGGCCTGAGCAGTGGGAGGG - Intronic
1152244753 17:79179518-79179540 GAGGGGGCTGGCCGGGGGAGAGG - Intronic
1152328824 17:79658648-79658670 GAGGAGGCAGTGGAATGGAGAGG - Intergenic
1152667611 17:81580343-81580365 GAGATGGCTGTGCAGTAGTGAGG - Intronic
1152747927 17:82049734-82049756 GAGGGGGCTGTGCAGCAGGCGGG + Exonic
1152953336 18:13319-13341 GTGGGCGCTGTGCAGTGGGCTGG - Intergenic
1153156887 18:2159892-2159914 TAAAGGGCTATGCAGTGGAGGGG - Intergenic
1153413298 18:4817843-4817865 GAAGAGGCAGTGCAGTGCAGTGG - Intergenic
1153506405 18:5803778-5803800 AAGGGGGCTGTACACTGCAGGGG + Intergenic
1154499844 18:14990503-14990525 CGAGGGGCTGTGCAGTGGGGAGG + Intergenic
1155982552 18:32196270-32196292 CTGGGGGCTGTGAAGTTGAGGGG + Intronic
1157697167 18:49732131-49732153 GAGGGAGCTATGAAGGGGAGGGG + Intergenic
1158080260 18:53581892-53581914 GAGGGGAAAGTGCAGTGGATAGG + Intergenic
1158256991 18:55562535-55562557 GAGGGGGCTGCCCAGTTGTGAGG - Intronic
1160164000 18:76494992-76495014 GAGGGGGGTGCGCCGGGGAGGGG - Intronic
1160758779 19:772090-772112 GAGGGGACTGGGCAGAGGAGGGG - Intergenic
1160975405 19:1790247-1790269 GAGGGGAGTGGGCGGTGGAGGGG - Intronic
1160975458 19:1790366-1790388 GAGGGGGAGGTGCAGGGGTGAGG - Intronic
1160979512 19:1810583-1810605 GAGGGGGCGGTGCAGGTGGGAGG - Intronic
1161241301 19:3225201-3225223 GAGGGGGCGGAGGAGGGGAGGGG - Intronic
1161245106 19:3247069-3247091 GAGGGGGTTGTGCTGGGGTGGGG + Intronic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1161354744 19:3812606-3812628 GAGGAGGCTGGGGAGTGGCGCGG - Intronic
1161480110 19:4506155-4506177 GAGGGCTCTGGGCAGAGGAGCGG - Intronic
1161482968 19:4519870-4519892 GAGGGTGCTGGGCAGAGGAGGGG - Intergenic
1161543644 19:4867177-4867199 GAGGGGGCTTTGCGGTGGCGGGG + Intronic
1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG + Intronic
1162130254 19:8521974-8521996 GGGGAGGGTGTGCAGTGGTGGGG + Intronic
1162478957 19:10916875-10916897 GAGAGCGCTGTGCAGGGCAGAGG - Intronic
1162485253 19:10956358-10956380 GAGAGGGCAGGGCAGGGGAGGGG - Intergenic
1162491551 19:10995508-10995530 GAGGGGGAAGTGGAGTGGAAGGG + Intronic
1163123754 19:15233146-15233168 GAGGGGGCGGTGGGGTGGGGTGG + Intronic
1163323058 19:16585861-16585883 CTGGGGCCTGTTCAGTGGAGTGG + Intronic
1163817451 19:19475489-19475511 GAGGGGCTGGGGCAGTGGAGGGG - Intronic
1163843792 19:19627765-19627787 GAGGGGGCGGTGCCGAGGCGTGG + Exonic
1164648639 19:29876309-29876331 GAAGGGGGTGTGCAGGGCAGAGG + Intergenic
1165858721 19:38895296-38895318 GAAGGGCCTTTGAAGTGGAGAGG - Intronic
1165924989 19:39321059-39321081 GCGGCGGCTCGGCAGTGGAGAGG - Intergenic
1166054133 19:40278649-40278671 GAAGGGGCTCTGCAGGGCAGTGG - Intronic
1166282125 19:41801139-41801161 GAGGAAGCTGTGCAGGGCAGGGG - Intronic
1166303280 19:41923864-41923886 GAGGGGGCTGTGCTGGGGGGTGG + Intronic
1166303311 19:41923947-41923969 GAGGGGGCTGTGCTGGGGGGAGG + Intronic
1166320982 19:42018771-42018793 GAGGGGGCCCTGGAGAGGAGGGG + Intronic
1166513291 19:43425688-43425710 GAGGGGGCAGTGCAGAGGGAGGG + Intergenic
1166765713 19:45251422-45251444 GAGGGGGCAGGGCGGGGGAGGGG - Exonic
1166977339 19:46612344-46612366 GAGGGGGGTGTGCAGTGCTCAGG + Intergenic
1167049344 19:47069034-47069056 CAGGCCGCTGTGCAGGGGAGCGG - Intronic
1167253420 19:48413818-48413840 GAGGGTGCTGAGCAGGGAAGGGG + Intronic
1167436325 19:49480692-49480714 AAGGGTGGTGAGCAGTGGAGGGG + Intronic
1167643830 19:50695396-50695418 GAGGGGGCCGGGCAGGGGGGAGG + Intronic
1167667687 19:50832234-50832256 GAGGGTGGTGAGCAGGGGAGGGG - Intronic
1167837356 19:52085157-52085179 GAGGGGGCTGTGCTCTGTATGGG - Intronic
1167896755 19:52587928-52587950 GAGGGGGCTGTGCTCTGCATGGG + Intergenic
1167906014 19:52661415-52661437 GAGGGGGCTGTGCTCTGCATGGG - Intronic
1167910905 19:52700920-52700942 GAGGAGGCTGGACAGTGGAAGGG + Intergenic
1167921860 19:52788693-52788715 GAGGGGGCTGTGCTCTGCATGGG - Intronic
1167932102 19:52874345-52874367 GAGGGGGCTGTGCTCTGCATGGG - Intronic
1167945026 19:52981252-52981274 GAGGGGGCTGTGCTCTGCATGGG - Intergenic
1167959576 19:53095170-53095192 GCGGGGCCTGGGCAGTGGGGAGG - Intronic
1168056795 19:53868872-53868894 GAGGGGGGCGCGCAGGGGAGGGG - Intronic
1168295171 19:55374609-55374631 GAGGGGGCTCTGCAGGGGGCCGG - Intergenic
1168324143 19:55529728-55529750 GAGGAGGCTGGGCAGTGAGGAGG - Exonic
1168405949 19:56110804-56110826 CAGGCTGCTGTGCGGTGGAGAGG - Intronic
1168562192 19:57393707-57393729 GAGGGGGGAGGGCAGGGGAGGGG + Intronic
1202702590 1_KI270712v1_random:175814-175836 GAGAGTGCTGAGCAGGGGAGGGG - Intergenic
925055412 2:853436-853458 AAAGGGAATGTGCAGTGGAGGGG + Intergenic
925199915 2:1958875-1958897 GAGGGGCCTCTGCAGTCGGGTGG - Intronic
925312824 2:2898854-2898876 GAGGCAGCTGTGCAGAGGACTGG - Intergenic
925610017 2:5694444-5694466 GAGGGGGCGGGGCGGGGGAGGGG + Exonic
926224323 2:10956355-10956377 GAGGGGTCTGGGGAGAGGAGGGG - Intergenic
926747135 2:16168061-16168083 CTGGGGGCAGTGCAGTGGGGCGG + Intergenic
927081559 2:19635774-19635796 CAGGGAGCTGTGCAGGCGAGAGG + Intergenic
927576784 2:24207469-24207491 GAGGGTGCTGTTCAGAGGCGCGG + Intronic
929816433 2:45236644-45236666 GGGTAGGCTGTGCAGTGGATGGG - Intergenic
929885264 2:45872446-45872468 GAGGGCTCTGTGCAGAGGAGTGG + Intronic
930533172 2:52615290-52615312 GAGGTGGCAGAGCAGTAGAGTGG + Intergenic
932091182 2:68807753-68807775 GAAGGTGATGTGCAGAGGAGGGG + Intronic
932430523 2:71671421-71671443 GAGGGGGCCTGGGAGTGGAGAGG + Intronic
932574723 2:72956323-72956345 GAAGGGGCTGGGCAGTGGAGGGG - Intronic
934173500 2:89559267-89559289 GAGAGTGCTGAGCAGGGGAGGGG - Intergenic
934283814 2:91633620-91633642 GAGAGTGCTGAGCAGGGGAGGGG - Intergenic
934743052 2:96739815-96739837 GAGGTGGTCGTGCAGTGGGGCGG - Intronic
934943461 2:98519359-98519381 GAGGGTGCTGTGCTATGGAAAGG - Intronic
934954925 2:98609107-98609129 GGGGGGCCTGCGAAGTGGAGGGG + Intronic
934987951 2:98900818-98900840 AACGAGGCTGTGGAGTGGAGTGG - Intronic
935331996 2:101984135-101984157 GAGGGAACTGTCCAGTGCAGAGG + Intergenic
936444654 2:112586141-112586163 GTGGGGGGTGGGCAGTGGGGTGG + Intronic
936488430 2:112947422-112947444 GAAGGCTCTCTGCAGTGGAGAGG - Intergenic
936518859 2:113199247-113199269 GAGGGCGCTGCGCAGCGGCGGGG - Intronic
936605076 2:113943889-113943911 GAAGGGGCTGTGGAGTAGAAAGG + Intronic
937071125 2:119064336-119064358 GAGTGGGGTGAGGAGTGGAGAGG - Intergenic
937161335 2:119764938-119764960 GTGGAGGCTGTGCAATGTAGGGG + Intronic
937316148 2:120933233-120933255 AAGGGTGCTCTGCAGAGGAGTGG - Intronic
937370896 2:121296485-121296507 GAGGGGGCTGAGGTGAGGAGGGG + Intergenic
937514464 2:122637863-122637885 GATGGGGCAGTGGAGTGAAGAGG + Intergenic
937854528 2:126662872-126662894 GAGGGAGCAGGGCAGTGGGGAGG - Intronic
938068248 2:128293205-128293227 GAGCGGGCTGTGCCTGGGAGCGG - Intronic
938493436 2:131777807-131777829 TGAGGGGCTGTGCAGTGGGGAGG - Intergenic
938499055 2:131820858-131820880 CGAGGGGCTGTGCAGTGGGGAGG + Intergenic
940031290 2:149264746-149264768 GTGGAGGCAGTTCAGTGGAGTGG - Intergenic
941127271 2:161599368-161599390 GAGGAGGGAGTGCAGTAGAGAGG + Intronic
942046646 2:172102801-172102823 GCGGGGGGCGGGCAGTGGAGGGG + Exonic
944916910 2:204370254-204370276 GATGGGGCTGTGGGGAGGAGGGG - Intergenic
945048895 2:205805374-205805396 GTGGGGGCTGTGTTGGGGAGGGG - Intergenic
945158225 2:206861474-206861496 GAGTGGATTATGCAGTGGAGAGG - Intergenic
945688019 2:212996262-212996284 GGAGGGGCTGTGCAGAGGGGTGG + Intergenic
946029950 2:216695748-216695770 GAGGGCGCTGTTCAGAGGGGAGG - Intergenic
946305814 2:218856510-218856532 GTGGGGGCAGTGGAGTGGTGGGG - Intergenic
946337268 2:219046271-219046293 GAGGAGACAGTACAGTGGAGTGG + Intergenic
947156079 2:227164277-227164299 GAGGTGGCTGCGCGGTGGGGAGG - Intergenic
947231842 2:227895544-227895566 GAGGGTGGTGAGCAGTGGAGAGG + Intronic
947257397 2:228181335-228181357 GTGGGGCCTGTGCGCTGGAGTGG - Intronic
947373470 2:229471902-229471924 GACGAGGCTGTAGAGTGGAGTGG - Intronic
947752814 2:232541571-232541593 GAGGGGCCTGGGCAGTGGTGGGG + Intronic
947889059 2:233600406-233600428 GAGCTGGCTGTGCAGTAGATTGG + Intergenic
948559201 2:238839475-238839497 GAGGGAGCGGAGCAGAGGAGGGG + Intergenic
948693890 2:239723031-239723053 GTGGGGGCTGGGCATCGGAGAGG + Intergenic
949048122 2:241881566-241881588 GAGGGGGCTGGGTAGGGGCGTGG + Intergenic
1168807713 20:682472-682494 GAGGAGGCAGTGTGGTGGAGTGG - Intergenic
1168815443 20:733683-733705 GAGGAGGCATTTCAGTGGAGAGG + Intergenic
1169218079 20:3804784-3804806 GAGGGGTCAATGCAGTGGAATGG - Intronic
1169253899 20:4083076-4083098 GAGGGGGCGGGGGAGAGGAGGGG + Intergenic
1169355938 20:4905291-4905313 GAGGGGGCTGTGTGGTCAAGAGG + Intronic
1169551378 20:6704916-6704938 GAGGGTGTTGTCCACTGGAGGGG + Intergenic
1170510087 20:17067491-17067513 GGGAGGGCTGTGGAGTGGGGTGG + Intergenic
1170562478 20:17569610-17569632 GAGGGGGATTTGGAGGGGAGAGG - Intergenic
1170645128 20:18190974-18190996 GAGGGGGCTGGGAGGTGTAGGGG + Intergenic
1171360164 20:24581879-24581901 GAGGAGGCTGTGCAGTTGGAAGG - Intronic
1171360178 20:24581959-24581981 GGGGAGGATGTGCAGTGGGGAGG - Intronic
1171381272 20:24736072-24736094 GTGGGGGGTGTGCTGTGGTGGGG - Intergenic
1171456734 20:25276565-25276587 GAGGAGGCTGGGCCGGGGAGAGG + Intronic
1171472104 20:25380495-25380517 CAGGGAGCTGTGCAGTAAAGGGG - Intronic
1172302973 20:33862910-33862932 GAGGAGGCGGTGGAGTGGGGCGG + Intergenic
1172450660 20:35020435-35020457 GAGGGGGCAGTGCCCTGGGGAGG - Intronic
1172772138 20:37388067-37388089 GAGAGGCCCGTGCAGGGGAGGGG + Intronic
1172959479 20:38788387-38788409 GAGGGGGCTATGCATAGGCGTGG + Intergenic
1173560645 20:44003062-44003084 CAGGAGGCAGTGCAGTGCAGTGG - Intronic
1173663372 20:44749436-44749458 GGGCAGGCTGAGCAGTGGAGGGG + Intronic
1173855120 20:46245358-46245380 GAGGAGGGTGTGGAGTAGAGGGG - Intronic
1174137576 20:48391096-48391118 GAGGGGGCAGGGAAGAGGAGGGG + Intergenic
1176050723 20:63118149-63118171 GGGGGCGCTGTGGAGTGGAGGGG - Intergenic
1176213740 20:63938723-63938745 GCGGGGGCTGGGCAGGGGCGTGG + Intergenic
1176614466 21:9016583-9016605 CAAGGGGCTGTGCAGTGGGGAGG + Intergenic
1176710737 21:10147288-10147310 CAAGGGGCTGTGCAGTGGGGAGG - Intergenic
1177831985 21:26149283-26149305 GAGGGAGCTGGCCAGTGGACTGG - Intronic
1178462252 21:32813619-32813641 CAGAGGTCTGTGGAGTGGAGAGG - Intronic
1178867843 21:36345219-36345241 GAGAGGGCAGGGCAGGGGAGGGG - Intronic
1178894536 21:36548086-36548108 GCAGGGGCCCTGCAGTGGAGGGG - Intronic
1179681682 21:43026149-43026171 GAGGGTGCTGAGCAGTGACGGGG - Intronic
1180016345 21:45087582-45087604 GAGGGGGCAGGGAAGTGGAGTGG + Intronic
1180069025 21:45426901-45426923 CAGGGGGCTGAGCAGAGGGGAGG + Intronic
1180076422 21:45465648-45465670 GAGGGGGCTGTGCTGGAGGGCGG + Intronic
1180161713 21:46001172-46001194 GAGGGGCCAGGGCGGTGGAGGGG + Intronic
1180161723 21:46001194-46001216 GAGGGGCCAGGGCACTGGAGGGG + Intronic
1180170242 21:46054827-46054849 GAGGGTGCTGTGCGGGGCAGAGG - Intergenic
1180170304 21:46054990-46055012 GAGGGGGCTGTGCAGGGCAGAGG - Intergenic
1180170314 21:46055017-46055039 GGAGGGGCTGTGCAGGGCAGAGG - Intergenic
1180294829 22:10874439-10874461 CGAGGGGCTGTGCAGTGGGGAGG - Intergenic
1180497635 22:15903853-15903875 CGAGGGGCTGTGCAGTGGGGAGG - Intergenic
1180593935 22:16961733-16961755 GAAGGGGCAGAGCAGTGGGGAGG - Intergenic
1181107982 22:20585929-20585951 GAGGGGCCTGAGCTGGGGAGGGG - Intronic
1181393944 22:22604703-22604725 GAGGAGGGTGAGCAGGGGAGGGG - Intergenic
1181589721 22:23876700-23876722 GACGGGGCTGTGCGGGGGGGTGG - Intronic
1181808733 22:25390911-25390933 AAGGGGCCTCTGAAGTGGAGGGG - Intronic
1182363139 22:29759361-29759383 GAGGGGGCTGTCCAGATGTGAGG - Intronic
1182422419 22:30254856-30254878 GATGAGGCTGCGCCGTGGAGGGG + Intergenic
1183316369 22:37139165-37139187 GAGGGTGCTGTGCCGTGAGGGGG - Exonic
1183363887 22:37397149-37397171 GGGGGTGCTGTGGAGTGGAGTGG - Intronic
1183383102 22:37500322-37500344 GAGCGAGCTGGGCAGTGGTGAGG + Intronic
1183440825 22:37822315-37822337 GAGGGGGCAGAGGAGAGGAGGGG + Intergenic
1184093359 22:42303851-42303873 GAGGGGAATGTGGAGAGGAGGGG + Intronic
1184183851 22:42850526-42850548 GAGGCTGGAGTGCAGTGGAGTGG - Intronic
1184268933 22:43366531-43366553 AAGGGGGCAGTGGGGTGGAGTGG - Intergenic
1184391994 22:44207976-44207998 GAGGGGGCATCGCAATGGAGGGG - Exonic
1184392611 22:44213139-44213161 GAAGGGGCTGGGTAGTGCAGTGG + Intronic
1184608551 22:45588109-45588131 GTGAGGGCTGTGCAGAGCAGGGG + Intronic
1184761772 22:46548998-46549020 GACGGGGCTGTGCAGTCGGCAGG + Intergenic
1185086232 22:48742468-48742490 GAGCTGGCGGCGCAGTGGAGCGG + Intronic
1185205727 22:49536982-49537004 GCGGGGACTCTGCAGTGAAGAGG - Intronic
1203297603 22_KI270736v1_random:54206-54228 TGGAGGGGTGTGCAGTGGAGTGG + Intergenic
1203308794 22_KI270736v1_random:128114-128136 TAGAGTGCTGTGGAGTGGAGTGG + Intergenic
1203309691 22_KI270736v1_random:133961-133983 AAGGGGGGAGTGCAGTGCAGTGG + Intergenic
949359597 3:3217545-3217567 GAGAGGTATTTGCAGTGGAGAGG - Intergenic
949553718 3:5133934-5133956 GGGTGTGCTGTGCAGTGCAGGGG - Intronic
949561389 3:5205859-5205881 GAGGGGGCTGTGCAAGCGTGTGG + Intronic
949648889 3:6131807-6131829 GGGGAGACTGTGCAGTGGTGGGG - Intergenic
950645437 3:14374092-14374114 GAGGGGGCAGTGCCCTGCAGAGG - Intergenic
950673984 3:14543738-14543760 GAGGGGGCTGAGCAGCCCAGGGG + Intergenic
951571729 3:24071391-24071413 GGGGAGACTGTGCAGTGGTGGGG - Intergenic
952264530 3:31772603-31772625 GCAGGGGCAGTGCAGTGCAGTGG - Intronic
952314046 3:32217055-32217077 GAAGGGGCTGTGCAATTGAGGGG + Intergenic
953877885 3:46676766-46676788 GAGGGGGCTGGGCCGAGGTGTGG - Intronic
954300701 3:49699393-49699415 GTGGGGGGTGGGCAGTGGAGAGG + Intronic
954361563 3:50125262-50125284 GCGGGGGGTGTGCAGAGGGGGGG + Intergenic
954413265 3:50380535-50380557 GGGGGTGCTGGGCAGTGGACGGG + Intronic
954635399 3:52068330-52068352 GAAGGGGCTGGGGAGGGGAGAGG + Intergenic
954882316 3:53844521-53844543 CAGGGGGCAGTGGAGAGGAGAGG - Intronic
954943035 3:54392661-54392683 GTGGGGGCTTTGGAGTGGAGGGG + Intronic
955744940 3:62131218-62131240 GAGGGGGATGAGAAGGGGAGGGG - Intronic
959549972 3:107643407-107643429 GAGGGGGGTGTGCAGTGTCATGG + Intronic
959590178 3:108071437-108071459 GAGGAGGTAGTGCAGTGCAGTGG + Intronic
960051163 3:113240887-113240909 GAGTGGGCTGTCCAGTAGGGTGG - Intronic
960829775 3:121834572-121834594 GAAGGGGATGTGTAGTGGGGAGG - Intronic
961132587 3:124482907-124482929 GAGGGGGATGTAGAGGGGAGGGG - Intronic
961770745 3:129248330-129248352 GAGTGGGCTGTGGAGAGGAGAGG - Intergenic
961786470 3:129350060-129350082 GAGGGTGCTGAGCAGAGGAGGGG - Intergenic
961810718 3:129520066-129520088 GAGGGGGCTTGGCAGTGGTCAGG - Intronic
962106573 3:132396344-132396366 GAGGGGCCTCTGCAGCGCAGCGG - Intergenic
962202609 3:133414071-133414093 GAGGGGTTTGTGGAGGGGAGAGG - Intronic
962202953 3:133415378-133415400 GAGGGGTTTGTGGAGGGGAGAGG - Intronic
962210356 3:133472268-133472290 GAGGGAGGTGTGCAGAGCAGTGG - Intronic
962263761 3:133931197-133931219 GAGGGAGTGGTGCAGAGGAGTGG + Intergenic
962364200 3:134766726-134766748 GAGGGTGCTGGTCAGAGGAGAGG + Intronic
962522932 3:136213734-136213756 CATGGGACTGTGCAGTGGAGTGG - Intergenic
962894379 3:139700659-139700681 GTGGGGGCTGAGCAAAGGAGAGG - Intergenic
963204091 3:142614921-142614943 GGTGGGGCTGGGCAGTGGTGAGG + Intronic
963552817 3:146745708-146745730 GTGGGGCCTGCCCAGTGGAGAGG - Intergenic
963738936 3:149055381-149055403 TAGGAGCTTGTGCAGTGGAGGGG - Exonic
964118810 3:153162085-153162107 GAGGGGGCGGGGCAGTGGGCGGG - Intergenic
964333834 3:155633867-155633889 GAGGGAGGAGTGCAGTGGTGCGG - Intronic
965009119 3:163063179-163063201 GAGGGGACTGAGAACTGGAGTGG + Intergenic
965107169 3:164371594-164371616 TAGGTTGGTGTGCAGTGGAGTGG - Intergenic
966809109 3:183827732-183827754 GAGGGGCCTGTGCAGGGCGGGGG + Intergenic
966911084 3:184560718-184560740 GAGGGTGCTGTGCAGTGCGCAGG - Intronic
968206534 3:196807224-196807246 GAAGGTGCTGTGCCGTGGAATGG + Intronic
968533977 4:1112721-1112743 GAAGGGGCCGTGGAGGGGAGGGG - Intronic
968659112 4:1791960-1791982 CCTGGGGCTGTGCACTGGAGGGG + Intergenic
968740692 4:2330388-2330410 TAGGGGACAGTGCAGAGGAGAGG + Intronic
968740746 4:2330633-2330655 GAGGGGACAGTGTAGTGGAGGGG + Intronic
968850282 4:3074001-3074023 GACGGGGCGGGGCCGTGGAGGGG - Intergenic
968899731 4:3425651-3425673 GTGGGGCCAGTGCAGGGGAGGGG + Intronic
968899776 4:3425784-3425806 GCGGGGCCAGTGCAGGGGAGGGG + Intronic
968899794 4:3425837-3425859 GCGGGGCCAGTGCAGGGGAGGGG + Intronic
968899812 4:3425890-3425912 GCGGGGCCAGTGCAGGGGAGGGG + Intronic
968899860 4:3426020-3426042 GCGGGGCCAGTGCAGGGGAGGGG + Intronic
968899878 4:3426073-3426095 GCGGGGCCAGTGCAGGGGAGGGG + Intronic
968899898 4:3426126-3426148 GTGGGGCCAGTGCAGGGGAGGGG + Intronic
968899918 4:3426179-3426201 GTGGGGCCAGTGCAGGGGAGGGG + Intronic
968899938 4:3426232-3426254 GTGGGGCCAGTGCAGGGGAGGGG + Intronic
968899958 4:3426285-3426307 GCGGGGCCAGTGCAGGGGAGGGG + Intronic
969115353 4:4867543-4867565 GTGGGAGCTGTTGAGTGGAGCGG - Intergenic
969278477 4:6153070-6153092 GAGGGGGATGTGCATGGGTGGGG - Intronic
969295719 4:6269827-6269849 GAGGGGGCGGGGCAGGGGCGGGG - Intronic
969537455 4:7765460-7765482 GAGGGCGCTGTCCAGTAGGGAGG - Intronic
969601063 4:8176653-8176675 GATGGGGCAGCCCAGTGGAGCGG + Intergenic
969665272 4:8553723-8553745 GATGTGGCTGTGAAGGGGAGGGG + Intergenic
969827359 4:9768080-9768102 GAGGGTGCTGAGCAGGGGAGGGG - Intergenic
970521895 4:16893179-16893201 GAGGGGGCTGGGTGGTGGAAAGG - Intronic
970607563 4:17694849-17694871 GAGGGGGCTCTGCAGTGTTGGGG + Intronic
970933578 4:21541558-21541580 TACTGGACTGTGCAGTGGAGGGG - Intronic
971294966 4:25379810-25379832 GAGGAGCATGTGCAGTGGTGAGG + Intronic
973634813 4:52852116-52852138 GAGGTGACTGTGAAGAGGAGAGG - Intergenic
976053217 4:81031829-81031851 GAAGGCGCGGAGCAGTGGAGGGG + Intronic
976317647 4:83676002-83676024 GAGGGTTCTGTGCTGTGGAGGGG + Intergenic
977922034 4:102656207-102656229 CAGGCTGGTGTGCAGTGGAGTGG - Intronic
977941995 4:102869047-102869069 GAGGGGGCTCGGGAGAGGAGTGG + Exonic
978200373 4:106018468-106018490 GTGGGGGGTGTGCAGGGGTGGGG - Intergenic
978572058 4:110148480-110148502 AAGGGGGTTGTGCGGGGGAGGGG + Intronic
979962213 4:127034630-127034652 AAGGGGTCTGTGCAGGTGAGGGG - Intergenic
980119046 4:128708849-128708871 GAGCGAGGTCTGCAGTGGAGGGG + Intergenic
980270455 4:130577224-130577246 GAGGTGGCTGTGCAGGAGACTGG - Intergenic
980638094 4:135535902-135535924 GAGGGGGGTGGGGAGGGGAGGGG + Intergenic
981269647 4:142830498-142830520 GAGGGGAATATGGAGTGGAGAGG + Intronic
982306477 4:153936878-153936900 GATGGGGCAGTGTGGTGGAGTGG + Intergenic
984620793 4:181949906-181949928 GAGGTGGCTGTGCAGAGGCCTGG - Intergenic
984708303 4:182863773-182863795 GAAGGGGCAGTGCTCTGGAGGGG - Intergenic
984933194 4:184866767-184866789 GTGAGGGCTGGGCAGTGGGGTGG - Intergenic
985484508 5:140864-140886 GGTGGGGGTGTGCAGGGGAGAGG - Intronic
985484522 5:140906-140928 GGGTGGGGTGTGCAGGGGAGTGG - Intronic
985484555 5:140991-141013 GGTGGGGGTGTGCAGGGGAGAGG - Intronic
985875566 5:2591462-2591484 GGGGAGGCTGTGCAGGTGAGAGG + Intergenic
986116646 5:4781846-4781868 GAGGGATCTGTGCAGAGGTGGGG + Intergenic
987022955 5:13893842-13893864 GACTGGGCTATGCAGAGGAGAGG + Intronic
987125768 5:14811074-14811096 GAGGAGGCTGTGCAGTCTACTGG - Intronic
987258500 5:16180233-16180255 GAACTGGCTGAGCAGTGGAGCGG + Intronic
988492309 5:31715214-31715236 GAGAGGGCTTTGTAGTAGAGAGG + Intronic
990021895 5:51137802-51137824 GAGGCTGCAGTGCAGTGGTGCGG - Intergenic
990446234 5:55896679-55896701 GAGGGGGAAGGGGAGTGGAGAGG - Intronic
990880140 5:60530027-60530049 GAGATGGCTGTGGAGAGGAGAGG + Intergenic
990881702 5:60546368-60546390 GAGGGGGAAGGGCAGTGGGGTGG - Intergenic
991550651 5:67832214-67832236 AAGATGGCTGTGCAGTGGACAGG + Intergenic
993917095 5:93756468-93756490 GAGGTGGCTGTGGTGTGCAGGGG - Intronic
994358037 5:98817011-98817033 GAGGTGGCAGGGCAGTGAAGTGG - Intergenic
995447871 5:112266460-112266482 GAGGGGGCTGTTGAGTGAACAGG + Intronic
995468643 5:112477216-112477238 CAGGCTGCTGTGCAGTGCAGTGG + Intergenic
996445411 5:123543511-123543533 GAAGGAGTTTTGCAGTGGAGTGG - Intronic
997582952 5:135028643-135028665 GAGGGGGCTGCGCAGGTGTGAGG + Exonic
998505553 5:142669257-142669279 TAGGGGGCTGGGCAGAGCAGAGG + Intronic
998549859 5:143067023-143067045 GAGGGGGAGGGGCAGAGGAGGGG - Intronic
1000165416 5:158643519-158643541 GTGGGGGCTGTGGAGCTGAGAGG - Intergenic
1000634021 5:163622925-163622947 GCAGGAGCTGTACAGTGGAGAGG + Intergenic
1001242949 5:170083929-170083951 CAGGGAGCTGTGCAGGGGAGGGG + Intergenic
1001314675 5:170633681-170633703 GAGGGGGCGGGGCGGAGGAGGGG + Intronic
1002106005 5:176879705-176879727 GAGATGGCTGTGGAGGGGAGGGG - Exonic
1002377917 5:178801447-178801469 GAGTGGGGTCTTCAGTGGAGTGG - Intergenic
1002449568 5:179311018-179311040 TGGGGGGCTGGGGAGTGGAGAGG - Intronic
1002662675 5:180802543-180802565 GAGGGGGCTTGGCTGGGGAGCGG - Intronic
1003080785 6:3019617-3019639 CAGTGGGCTGTGCAGGGGATGGG - Exonic
1004413113 6:15400176-15400198 GAGGGGCCTGCGCAGGGCAGGGG + Intronic
1005478672 6:26234157-26234179 GAGGGGGGAGTGGGGTGGAGAGG - Intergenic
1005823941 6:29621028-29621050 GAGGGGGCCTTGCAGGGGAAAGG - Intronic
1006119303 6:31794806-31794828 GAGGGGGTTGTACAGAAGAGGGG - Intronic
1006523433 6:34585348-34585370 GAGAGGGCAGTGTACTGGAGAGG - Intergenic
1006741860 6:36314626-36314648 GAGGGTGCTGTGGAGGGGTGGGG - Intergenic
1007171050 6:39863794-39863816 GAGGGGGATGTGCAGCGGGGAGG - Intronic
1007343460 6:41208914-41208936 GAGGGGTCAGTGCAGGGGTGAGG + Intergenic
1007383650 6:41505759-41505781 GAGGTGGCTCAGCAGTTGAGCGG + Intergenic
1007411463 6:41664506-41664528 GTGGGGGCCCTGCAGAGGAGGGG + Intergenic
1007812037 6:44493257-44493279 GAGGGTTCTGAGCAGAGGAGAGG - Intergenic
1008440514 6:51527072-51527094 GGTGGGGCTGTGTAGTGGACAGG + Intergenic
1013222968 6:108095991-108096013 GAGGAGGGTGGGCAGTAGAGGGG + Intronic
1013371264 6:109472938-109472960 CAGGAGGCTGTGCAGTAGTGGGG - Intronic
1013575811 6:111482984-111483006 GAGGGGGCCGTGCCGAGAAGGGG - Exonic
1014379208 6:120717876-120717898 CAGGGGGCTGGGCAGGGTAGTGG + Intergenic
1015311052 6:131767784-131767806 AAGGGTGCTGTGGGGTGGAGTGG - Intergenic
1015776779 6:136822668-136822690 GAGTGCGGTGTGCGGTGGAGCGG + Exonic
1016325351 6:142894841-142894863 GTGGGGACAGTGTAGTGGAGTGG - Intronic
1017788948 6:157778795-157778817 TAGGAGCCTGTGCAGTGCAGTGG - Intronic
1017997389 6:159544043-159544065 GGGGAGGCTGTGCAGGGGTGCGG + Intergenic
1018373125 6:163186778-163186800 GAGGGAGCAGAGCGGTGGAGAGG - Intronic
1018602781 6:165563174-165563196 GAGGGGGAGGGGCAGGGGAGAGG + Intronic
1018930905 6:168239665-168239687 GAGGGGCCTGTGGACTGGGGAGG + Intergenic
1018969703 6:168517815-168517837 CAGGGGCCTGGGCGGTGGAGGGG + Intronic
1019363463 7:617898-617920 GAGGTGTCTGTGCAGGGGCGGGG - Intronic
1019373297 7:674931-674953 GCAGGGGCTGTGCAGAGGAGTGG - Intronic
1020477036 7:8608370-8608392 CAGGCTGCAGTGCAGTGGAGTGG + Intronic
1022097559 7:27150506-27150528 GAGAGGGCTGTGAAGGGCAGAGG - Intronic
1022673034 7:32473750-32473772 CAGGGTGCTGTACAGGGGAGTGG - Intergenic
1022761903 7:33364650-33364672 GAGGGGGAAGGGGAGTGGAGAGG - Intronic
1023442689 7:40200671-40200693 GATGGGTCTGAGCAGTGGAGGGG + Intronic
1023939747 7:44761922-44761944 GAGGGGGCGGTGCTGTGGCGTGG + Intronic
1023965468 7:44961436-44961458 GAGGGGGCTGAGCACTGAGGGGG + Intergenic
1024200798 7:47103910-47103932 GAGGGCTCTGTGGAGTGGTGTGG - Intergenic
1024506286 7:50165006-50165028 GAGGTGTCTGGGCAGAGGAGGGG + Intergenic
1024586786 7:50849252-50849274 GGGTGAGCTGTGCAGTGGAGTGG - Intergenic
1024721556 7:52142473-52142495 GAGGGGGCTGTGCATGTGTGGGG + Intergenic
1024996291 7:55275333-55275355 CATGGGGCTGTGCAGTGGGAAGG - Intergenic
1026521918 7:71124965-71124987 GATAGGGCTCTGCAGAGGAGTGG + Intergenic
1026788457 7:73316823-73316845 GAAGGGGCTGTGCAGGGGAGGGG - Intronic
1026790867 7:73330746-73330768 AAAGGGGCTGTTCACTGGAGGGG + Intronic
1026796074 7:73366927-73366949 GATGGGGCTGTGGGGAGGAGGGG - Intergenic
1026944046 7:74305185-74305207 GAGGGGGCAGAGCAGTGGGTGGG - Intronic
1029404473 7:100366443-100366465 GAGGGGGCTGGATGGTGGAGGGG + Intronic
1029537954 7:101166798-101166820 GAGGGGGCAGGGGAGAGGAGAGG + Intergenic
1029650378 7:101887145-101887167 GAAGGGGCTTTGCTGGGGAGGGG + Intronic
1029925008 7:104306208-104306230 GAAGGGGCTGTGAATTGGAAGGG + Intergenic
1030058619 7:105605159-105605181 GAGGGGTGTGTGCAGTCAAGGGG + Exonic
1031996227 7:128233201-128233223 GCAGGGGCTGTGAGGTGGAGCGG + Intergenic
1032471517 7:132182448-132182470 AAGGGGGCTGTGCTGTTGACTGG - Intronic
1032800207 7:135311780-135311802 CAGGGAGCTGGGCATTGGAGTGG - Intergenic
1034086560 7:148327834-148327856 GTGGGGGCGGTGCAGGGCAGTGG - Intronic
1034461369 7:151199704-151199726 GAGGGGGCTGGGCTGGGGACTGG - Intronic
1035302975 7:157909550-157909572 GAAGGGGCTGAGCAGGGGCGAGG - Intronic
1035305479 7:157928835-157928857 GAGAGGGCAGTGCAGAGGATAGG + Intronic
1035354860 7:158270802-158270824 GAGGGGGCGGTCCAGGTGAGGGG - Intronic
1035737252 8:1897937-1897959 GAGGGGGCTGTGCAGTGGAGAGG - Intronic
1036600362 8:10255281-10255303 GAGGAGGCTGTGCAGAGGGAAGG + Intronic
1036658553 8:10693009-10693031 TAGGGAGATGGGCAGTGGAGAGG + Intronic
1036683990 8:10896416-10896438 GCGGGGGCTCTGGAGTGGTGGGG - Intronic
1036791912 8:11726622-11726644 GTGGGGGCGGTGCAGAGGGGTGG + Intronic
1036928090 8:12927181-12927203 CAGGTGGATGTGCAATGGAGAGG + Intergenic
1036950320 8:13133510-13133532 GAGGGGGCGGGACAGAGGAGAGG - Intronic
1037127149 8:15365366-15365388 GAGAGGGCTGGGGAGGGGAGGGG + Intergenic
1037818290 8:22123528-22123550 GCTGGGGCTGTGCAGTGGGTAGG + Intronic
1038240103 8:25800495-25800517 GGGGGGGTTGGGCATTGGAGAGG - Intergenic
1038508645 8:28109021-28109043 GGGGGTGTTGTGCAGTGCAGGGG + Intronic
1039394860 8:37216892-37216914 GAGGGGCCAGTGCAGAGAAGTGG + Intergenic
1039468029 8:37797460-37797482 GAGGGTGGTGTGCAGCGGCGGGG + Exonic
1039989168 8:42473490-42473512 GAGGGAGCTGTGCAGCTGTGGGG - Intronic
1040392695 8:46963082-46963104 GAGGGGGCAGTGCATTGCACAGG - Intergenic
1041780031 8:61568028-61568050 GACAGGCCAGTGCAGTGGAGGGG + Intronic
1043853981 8:85244445-85244467 GAGCCGGCTGTGCAGAGGACTGG - Intronic
1043863780 8:85352620-85352642 GAAGGGGCTGGGCAGAGCAGGGG - Intronic
1043965083 8:86465219-86465241 GAGGGGGCTGTGGTGGGGAAAGG - Intronic
1044820691 8:96153997-96154019 CAGTGGGCTGGGAAGTGGAGTGG + Intronic
1044831509 8:96254429-96254451 GAGGGAGCTGGGGAGTGGGGTGG - Intronic
1046296723 8:112229471-112229493 CAGGCTGCAGTGCAGTGGAGTGG + Intronic
1046529723 8:115427837-115427859 GAGGGGGCAGTGCTGGGGAGGGG + Intronic
1048024483 8:130573013-130573035 GCGAGGGCTGTGCAGGTGAGAGG + Intergenic
1049073070 8:140372186-140372208 GAAGGCGCTGTGCAGTGGGCAGG - Intronic
1049286465 8:141778098-141778120 GAGGGGTCACTGCAGTGCAGTGG - Intergenic
1049391490 8:142373816-142373838 GAGGGAGCTAGGCAGGGGAGCGG + Intronic
1049404674 8:142447078-142447100 GAGGGGGGTGAGCAGGTGAGGGG + Intergenic
1049443814 8:142620981-142621003 GAGGGTGGTGGGCAGTGGAGTGG - Intergenic
1049472128 8:142781157-142781179 TTGGGGGCTGGCCAGTGGAGTGG + Intergenic
1049578557 8:143400598-143400620 GAGAGGGGTGTGGAGTGGTGTGG - Intergenic
1049591616 8:143465368-143465390 GGGGCGGCAGTGCAGTGAAGGGG - Intronic
1050010125 9:1177451-1177473 GAGGAGGGTGTGGAGTGCAGAGG + Intergenic
1050720092 9:8578599-8578621 GATGGGGCTGAGAAGTGGAAAGG + Intronic
1050971534 9:11882834-11882856 GAGAGGGCAGGGCAGGGGAGGGG - Intergenic
1052068231 9:24049253-24049275 CAAGGGGCTGTGGAGTGGACTGG + Intergenic
1052282667 9:26751079-26751101 GAAGGGGCAGTGCAGATGAGAGG - Intergenic
1053003117 9:34588795-34588817 GTGGGGGCTGGGCCGTGGGGAGG - Intronic
1053014413 9:34653865-34653887 GAGGGGGCGGGGCAGGGAAGGGG + Intronic
1053054776 9:34987993-34988015 GAGGGGGATGAGGAGGGGAGGGG - Intergenic
1053240033 9:36487707-36487729 GAGGGGGCGGGGACGTGGAGGGG + Intergenic
1053647720 9:40132984-40133006 CAAGGGGCTGTGCAGTGGGGAGG - Intergenic
1053758011 9:41330859-41330881 CAAGGGGCTGTGCAGTGGGGAGG + Intergenic
1054152380 9:61615847-61615869 GAGGGAGGTGGGCAGAGGAGGGG + Intergenic
1054328691 9:63730935-63730957 CAAGGGGCTGGGCAGTGGGGAGG - Intergenic
1054536859 9:66243186-66243208 CAAGGGGCTGTGCAGTGGGGAGG + Intergenic
1055078142 9:72238107-72238129 GATGAGGCTGGGCAGTGGATGGG - Intronic
1055971838 9:81919517-81919539 GAGGGAGCTGTGTAGTTGCGGGG - Intergenic
1055973591 9:81934589-81934611 GAGGGAGCTGTGTAGTTGCGGGG - Intergenic
1056512826 9:87321857-87321879 GAAGGGGCTGGGCAGAGAAGAGG - Intergenic
1056760266 9:89409481-89409503 GAGGGGGCTGTGCATGTGTGGGG + Intronic
1057025096 9:91728864-91728886 GAGACGCCTGTGCTGTGGAGTGG - Intronic
1057078291 9:92152675-92152697 GAAGGGGCTGAGCAGTGCTGGGG - Intergenic
1057195065 9:93112134-93112156 CTGGGGGCTGCGCAGGGGAGTGG - Intronic
1057666256 9:97047754-97047776 AAGGGTGCTGTGCAGAGGTGTGG - Intergenic
1057843147 9:98502342-98502364 GAGGAGGCCTTGCAGTGGAGTGG - Intronic
1057944457 9:99312794-99312816 TAGGGGGGTGGTCAGTGGAGGGG + Intergenic
1057947849 9:99345115-99345137 GAGGTGCCTGAGCAGGGGAGTGG + Intergenic
1058110700 9:101028698-101028720 GAGGGGGCGGAGGAGGGGAGAGG - Exonic
1058110815 9:101029247-101029269 GCTGGGGCTGTGCAGAGGAGAGG + Intronic
1059123573 9:111662777-111662799 GAGAGGGCTGTGGAATGCAGAGG + Intronic
1059423303 9:114205938-114205960 GAGGGGGCTTTCCAGGGGACTGG + Intronic
1060208929 9:121698965-121698987 GAGGGGGCGGGGCTGCGGAGGGG - Intronic
1060219044 9:121754819-121754841 GAGCTGGCTGTGGAGAGGAGAGG - Intronic
1060726930 9:126012299-126012321 AAGGGGGCTGTCCAGGGAAGGGG - Intergenic
1061230937 9:129315508-129315530 CAGGGGGCTGGGAGGTGGAGCGG - Intergenic
1061237768 9:129352296-129352318 GAGGGGGCGGGGCAGGGGCGGGG - Intergenic
1061272663 9:129552202-129552224 GCTGGGGCTATGCAGTGGGGAGG + Intergenic
1061399764 9:130361994-130362016 GAGGGGGCACTGCAGGGCAGGGG - Intronic
1061421377 9:130474560-130474582 GATGGGGCTGTGGAGTTGTGTGG + Intronic
1061444880 9:130632121-130632143 GAGGGAGGTGAGCAGTGAAGAGG + Intronic
1062085201 9:134644560-134644582 GGGGCGGCTGTCCACTGGAGAGG + Intronic
1062137273 9:134936132-134936154 GAGGTGACTGTGCAGGGGTGAGG - Intergenic
1062216481 9:135392333-135392355 GAGGAGCCTGGCCAGTGGAGGGG + Intergenic
1062289174 9:135786898-135786920 GAGGCAGCTGTGGGGTGGAGAGG + Intronic
1062298364 9:135847861-135847883 GAGGGGGCAGGGAAGGGGAGGGG + Intronic
1062316917 9:135971872-135971894 GTGGAGGCTGTGCACTTGAGGGG - Intergenic
1062405492 9:136394370-136394392 GTGGGGGCTGGGCCGTGGAGAGG - Intronic
1062408232 9:136408225-136408247 GCTGGGTGTGTGCAGTGGAGTGG - Intronic
1062454884 9:136630654-136630676 GAGGGGGCTGAGAAGGGGAGGGG + Intergenic
1062462838 9:136669051-136669073 GAGGGGGGTGCCCAGTGGAGTGG - Intronic
1062694285 9:137865222-137865244 GAGGGGGCTGGGGAGAGGCGAGG + Intronic
1202795497 9_KI270719v1_random:116276-116298 CAAGGGGCTGTGCAGTGGGGAGG - Intergenic
1189251076 X:39601158-39601180 TGGGGGGCTGGGCAGTGGTGGGG - Intergenic
1189251159 X:39601527-39601549 GAGGGGGCTGAGAGGTGGACAGG + Intergenic
1189278809 X:39806477-39806499 GAGGGGGCTATGGATTGGAGAGG + Intergenic
1189317133 X:40064189-40064211 GTGGGGGCGCAGCAGTGGAGCGG - Intronic
1189626326 X:42901058-42901080 GAGAGGGTTGTACAGGGGAGAGG - Intergenic
1191156602 X:57281064-57281086 GAGGGGATTGGGCAGTGGTGTGG + Intergenic
1192221966 X:69203516-69203538 GAGGGGGAGGTGCAGGGGAGTGG - Intergenic
1192227336 X:69238408-69238430 GAGGGAGCTGGGCACTGGAGGGG - Intergenic
1194214380 X:91110511-91110533 GAGGTGGCAGGGCAGTGAAGAGG + Intergenic
1194889782 X:99364391-99364413 TAGGGGGCTGTTCAGTTGTGAGG + Intergenic
1195374245 X:104210933-104210955 GAGGAGGCTGTGAAGTCAAGGGG + Intergenic
1199598504 X:149526346-149526368 GAGGGGGCTGTGCTTAGGTGGGG + Intronic
1199756608 X:150870749-150870771 GATGGGGGGGTGCAGTGCAGTGG - Intronic
1199758292 X:150885161-150885183 GAGGGGGCTGTGACTGGGAGGGG + Intronic
1199858462 X:151779136-151779158 GTGGGGGCTGGGGGGTGGAGGGG + Intergenic
1200092045 X:153640522-153640544 GTGGGAGCTGTGCAGGGGCGAGG + Intergenic
1201131558 Y:10955540-10955562 GTGAGGGGAGTGCAGTGGAGTGG - Intergenic
1201136175 Y:10991794-10991816 TGGTGGGCTGTGGAGTGGAGAGG - Intergenic
1201138395 Y:11008103-11008125 GGGAGTGGTGTGCAGTGGAGTGG - Intergenic
1201437561 Y:13975798-13975820 GAGGGGGCTGGGAAGGGTAGGGG - Intergenic