ID: 1035738182

View in Genome Browser
Species Human (GRCh38)
Location 8:1904580-1904602
Sequence TCGGAGGTTCAAGTGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035738182_1035738188 -6 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG No data
1035738182_1035738190 8 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738190 8:1904611-1904633 GGGGCACGGAGCAAGCCCAGAGG No data
1035738182_1035738192 20 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738192 8:1904623-1904645 AAGCCCAGAGGCCCAGGAAGAGG No data
1035738182_1035738194 22 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738194 8:1904625-1904647 GCCCAGAGGCCCAGGAAGAGGGG No data
1035738182_1035738193 21 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738193 8:1904624-1904646 AGCCCAGAGGCCCAGGAAGAGGG No data
1035738182_1035738191 14 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738191 8:1904617-1904639 CGGAGCAAGCCCAGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035738182 Original CRISPR TCGGAGGTTCAAGTGCCACA GGG (reversed) Intronic
900008056 1:78356-78378 TCAGAGGTTCAAGTGCAGCCTGG + Intergenic
900881596 1:5385601-5385623 TCTGAGGTCAAGGTGCCACATGG + Intergenic
905262288 1:36728376-36728398 TCGAAGGTACAAGAGCCCCAAGG - Intergenic
910895532 1:92065440-92065462 TCAGAGTTGCAAATGCCACAAGG + Intergenic
915484838 1:156212997-156213019 TTGGAGGTTCAACTTCAACATGG + Exonic
918070717 1:181131768-181131790 TCCAAGGTTCCAGTGCCACTGGG - Intergenic
1063937524 10:11094037-11094059 TCGGAGATTCAATGTCCACATGG + Intronic
1067696981 10:48542704-48542726 TCGGCAGTGCCAGTGCCACAGGG + Intronic
1068983363 10:63084593-63084615 TGGGAGGTTCATGGGCCAAAGGG - Intergenic
1069215603 10:65815194-65815216 TTGGAGGTTGATGTGTCACATGG - Intergenic
1076319368 10:129566688-129566710 GCGGAGATTCAGGTGCCATAGGG + Intronic
1077352968 11:2101248-2101270 ACCCAGCTTCAAGTGCCACACGG - Intergenic
1079609595 11:22415442-22415464 TCAGAGATTCAAATGCCACTAGG + Intergenic
1080456615 11:32425256-32425278 TCAGAGGGTCAAATGCAACAAGG + Intronic
1081726701 11:45334855-45334877 GCAGAGCTTCAAGTGCCAAATGG + Intergenic
1082125082 11:48422963-48422985 TCGGGAGTTCAAGACCCACATGG - Intergenic
1083976387 11:66124951-66124973 TCGCAGTTCCAGGTGCCACAGGG + Intronic
1084494375 11:69495596-69495618 TCTGAGGTTCTGGTGCCACCTGG + Intergenic
1089758756 11:120707457-120707479 TCTGAGGTTACAGAGCCACATGG - Intronic
1091301120 11:134508838-134508860 TGGGAGGTGCATGTGCCGCACGG + Intergenic
1092711842 12:11346436-11346458 TGGGTGGTTCAAATGCCAGAAGG - Intergenic
1093115610 12:15207181-15207203 TCTGTGATTCAAGTGCCACAAGG + Intronic
1100564132 12:95778608-95778630 TCAGAGATTCAAGTTCCTCATGG - Intronic
1107811245 13:44201773-44201795 TCTGAGGATCCAGTGACACAGGG - Intergenic
1109436499 13:62310595-62310617 TCAGAGGTTCAGGTGTCACAGGG - Intergenic
1113707138 13:112442261-112442283 CCGGAGGTTGAGTTGCCACAGGG - Intergenic
1121059531 14:90892722-90892744 TCAGACCTTAAAGTGCCACATGG + Intronic
1132445501 15:101913754-101913776 TCAGAGGTTCAAGTGCAGCCTGG - Intergenic
1133213151 16:4273955-4273977 GCGGAGGGGCAAGTCCCACACGG - Intergenic
1135949496 16:26900499-26900521 TCAGGGGTTCATGTGCAACATGG + Intergenic
1140866702 16:79068454-79068476 TCATATGTTCACGTGCCACATGG + Intronic
1142007430 16:87696182-87696204 TCTGAGGTCCCAGTTCCACAGGG + Intronic
1146287765 17:31585737-31585759 TTGGAGGTTGAAGCTCCACAGGG - Intergenic
1155243726 18:23887333-23887355 TCTGAGGTTTAAAAGCCACAGGG + Intronic
1156358168 18:36360687-36360709 TCAGAGGTTCATGGGCCTCAGGG - Intronic
1159461853 18:68731557-68731579 TCTGAGGTTCCATTGCCTCAAGG + Intronic
1160639810 19:119953-119975 TCAGAGGTTCAAGTGCAGCCTGG + Intergenic
1163024571 19:14503005-14503027 TCAGGGGTTCAAGACCCACATGG - Intergenic
1167682643 19:50933939-50933961 TCGAATGTTCAAGTGCAACTGGG - Intergenic
926255618 2:11193375-11193397 TCGGAGGTAAAAGGGCTACAAGG + Intronic
928897379 2:36281024-36281046 CGGGAGGCTGAAGTGCCACAGGG - Intergenic
931858005 2:66323976-66323998 TCAGAGATTCAAGTGGCAGAAGG + Intergenic
932606320 2:73168113-73168135 TCAGAGGTTGTAGTGCCACTGGG - Intergenic
933926109 2:87092329-87092351 TCAGAGGTTGTAGTGCCACTGGG + Intergenic
937018740 2:118631425-118631447 TCGGGGCTTCAAGACCCACAGGG + Intergenic
940753594 2:157656548-157656570 TTGGTGGTAGAAGTGCCACATGG - Intergenic
942352767 2:175070443-175070465 TTGTAGGTTCCAATGCCACATGG + Intergenic
947674056 2:231961589-231961611 TCGGCGGTTCAGCTGCGACAAGG - Exonic
1179187524 21:39096357-39096379 TGAGAGGTTCAAGAGACACACGG + Intergenic
1179431901 21:41327067-41327089 TGGGAGGCTGAAGGGCCACAGGG - Intronic
1183443713 22:37838839-37838861 TAGGAGGTTCAAGGCCCTCAGGG + Intronic
1184077863 22:42194809-42194831 TGGCAGGTCCAAGTGCCACATGG + Intronic
955871450 3:63442623-63442645 TCAGAGGCTTAAGTGCGACATGG - Intronic
957001016 3:74884890-74884912 TGAGGGGTTCCAGTGCCACAAGG + Intergenic
962678525 3:137774753-137774775 TGGGAGGTTCAACTGACACCTGG + Intergenic
966384097 3:179376817-179376839 TCTGGGATTCAGGTGCCACATGG + Intronic
969316564 4:6384982-6385004 TTAGAGGTTCAAGTGAGACAAGG + Intronic
974389138 4:61242396-61242418 TCGGAGTGTGAATTGCCACAAGG + Intronic
979599779 4:122574907-122574929 TCGGAGATTGAACTGCAACATGG - Intergenic
997645849 5:135481480-135481502 TTTGAGGTTCATGAGCCACATGG - Intergenic
1000744882 5:165020314-165020336 CTGGAGCTTCATGTGCCACAAGG - Intergenic
1002747161 6:68360-68382 TCAGAGGTTCAAGTGCAGCCTGG + Intergenic
1003991897 6:11494522-11494544 TCGGAGGTGCAAGGGCAATAGGG + Intergenic
1005943344 6:30577908-30577930 CAGCAGGTACAAGTGCCACAGGG + Exonic
1008810734 6:55494568-55494590 TGGGAAGATCAAGTTCCACAAGG - Intronic
1013177722 6:107691455-107691477 TCGGAGGTTCCTGGGCCCCACGG + Intergenic
1018639199 6:165891316-165891338 TCTGAGGCTCAGGTGCCACCAGG + Intronic
1022508323 7:30920567-30920589 TGGGAGGTTCAAAGGCCAAAGGG - Intronic
1026739632 7:72970543-72970565 TCAGAGGTTCAAGAGCTTCATGG - Intergenic
1027104101 7:75394527-75394549 TCAGAGGTTCAAGAGCTTCATGG + Intergenic
1033603579 7:142908559-142908581 TCCAAGATTCAAGTGCCCCAGGG + Exonic
1035738182 8:1904580-1904602 TCGGAGGTTCAAGTGCCACAGGG - Intronic
1047308087 8:123669357-123669379 TCTGAGGTGCAGGTGCCAGATGG - Intergenic
1048485437 8:134843749-134843771 TAGGAAGTTCAAGTGGCAGAGGG + Intergenic
1048522026 8:135165117-135165139 GAGGAGGGTCAAATGCCACATGG - Intergenic
1057336757 9:94161674-94161696 GGGGAGGTTCAAGTGCCATCTGG + Intergenic
1059304274 9:113341528-113341550 TCAGAGTTTCAAGTGGCATACGG - Intergenic
1189310534 X:40014574-40014596 GCGGAGATTAAAGTGCCATACGG - Intergenic
1190953808 X:55171901-55171923 TCAGAGGTAGAAGTGCCTCAAGG + Intronic
1194193208 X:90861705-90861727 TGGGAGGTTCCAGTTCAACATGG - Intergenic
1195755445 X:108194780-108194802 TAGGAGGTACAAGGGCCATAAGG + Intronic
1200144769 X:153920883-153920905 TCTGAGGTCCAAGTTCCAGAGGG - Intronic
1200539822 Y:4444155-4444177 TGGGAGGTTCCAGTTCAACATGG - Intergenic