ID: 1035738183

View in Genome Browser
Species Human (GRCh38)
Location 8:1904581-1904603
Sequence TTCGGAGGTTCAAGTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035738183_1035738194 21 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738194 8:1904625-1904647 GCCCAGAGGCCCAGGAAGAGGGG No data
1035738183_1035738188 -7 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG No data
1035738183_1035738192 19 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738192 8:1904623-1904645 AAGCCCAGAGGCCCAGGAAGAGG No data
1035738183_1035738190 7 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738190 8:1904611-1904633 GGGGCACGGAGCAAGCCCAGAGG No data
1035738183_1035738193 20 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738193 8:1904624-1904646 AGCCCAGAGGCCCAGGAAGAGGG No data
1035738183_1035738191 13 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738191 8:1904617-1904639 CGGAGCAAGCCCAGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035738183 Original CRISPR TTCGGAGGTTCAAGTGCCAC AGG (reversed) Intronic
900271864 1:1794474-1794496 TTCAGGGGTTCCAGTGGCACTGG + Intronic
911691208 1:100836842-100836864 TACTGAGTTTCAAGTCCCACTGG - Intergenic
918070718 1:181131769-181131791 ATCCAAGGTTCCAGTGCCACTGG - Intergenic
1064186619 10:13167530-13167552 TGCGGAGGTTGAAGTGCCCCAGG + Intronic
1066789214 10:39044425-39044447 TTAGGAGGTTCCAGCGCAACAGG - Intergenic
1069835399 10:71304754-71304776 TTGGGAGGGTCTTGTGCCACTGG - Intergenic
1072777378 10:98212453-98212475 TTTGGAGGTTCAAATGTCACAGG - Intronic
1076319367 10:129566687-129566709 TGCGGAGATTCAGGTGCCATAGG + Intronic
1090947550 11:131445214-131445236 TACGGAGATACAAATGCCACAGG - Intronic
1095775333 12:46003921-46003943 TCCTGATGTGCAAGTGCCACAGG - Intergenic
1096647895 12:53048174-53048196 TTCCGAGGTGCGAGTGCCACAGG + Intronic
1104356945 12:128095324-128095346 TTCTGAGGTTCCAGTGCTGCTGG + Intergenic
1107811246 13:44201774-44201796 TTCTGAGGATCCAGTGACACAGG - Intergenic
1109436500 13:62310596-62310618 ATCAGAGGTTCAGGTGTCACAGG - Intergenic
1113707140 13:112442262-112442284 TCCGGAGGTTGAGTTGCCACAGG - Intergenic
1114648164 14:24267131-24267153 TTCGGAGGTACAGGGGCCAGTGG + Intronic
1116895483 14:50311871-50311893 ATCCGAGGTTGGAGTGCCACAGG + Intronic
1119262158 14:73244367-73244389 TTTGGAGTTTCAGGGGCCACTGG - Intronic
1131032352 15:89196866-89196888 TTTGGATATTCAAGTACCACAGG - Exonic
1142007429 16:87696181-87696203 TTCTGAGGTCCCAGTTCCACAGG + Intronic
1144207353 17:12988497-12988519 TTCAGAGGAACAAGTGGCACTGG + Intronic
1144809970 17:17992775-17992797 TCCGGCGGTTCAAGTGCCTGCGG + Exonic
1146287766 17:31585738-31585760 TTTGGAGGTTGAAGCTCCACAGG - Intergenic
1164452019 19:28374526-28374548 TTTGTAGGTTCAGGTGACACTGG - Intergenic
1167682644 19:50933940-50933962 TTCGAATGTTCAAGTGCAACTGG - Intergenic
928135559 2:28685042-28685064 TCCGGAGGTTCACATGCCAAAGG + Intergenic
928897380 2:36281025-36281047 TCGGGAGGCTGAAGTGCCACAGG - Intergenic
931541587 2:63335323-63335345 TTAGGAGGTTTATTTGCCACAGG - Intronic
932606321 2:73168114-73168136 CTCAGAGGTTGTAGTGCCACTGG - Intergenic
933926108 2:87092328-87092350 CTCAGAGGTTGTAGTGCCACTGG + Intergenic
936553143 2:113468123-113468145 TTTTGAGTTTGAAGTGCCACTGG + Intronic
937018739 2:118631424-118631446 TTCGGGGCTTCAAGACCCACAGG + Intergenic
939177143 2:138761601-138761623 TTCTTAGCTTCAAGTGGCACAGG - Intronic
947641550 2:231710157-231710179 TTCGGCGGGCCAAGTCCCACGGG - Intronic
1172016777 20:31880202-31880224 TTCTGAGGTTCAACTTCCCCTGG - Intronic
954777281 3:53031218-53031240 TTCGCAGGTGCATGGGCCACAGG - Intronic
955988072 3:64595803-64595825 TTTGGAGGTCCCAGTGCCAAGGG - Intronic
956340729 3:68221037-68221059 TTAGCAGCTTCAAGTCCCACGGG + Intronic
957244809 3:77703202-77703224 CTCGGAGGTTGTAGTCCCACAGG - Intergenic
966933789 3:184692293-184692315 TATGGAGGTTCAAAAGCCACGGG + Intergenic
972336602 4:38112597-38112619 TTCTGAGCTTCACGTGCCAGAGG + Intronic
980978586 4:139634371-139634393 TTTGGAGGTTCCAGCGCAACTGG - Intergenic
1005376319 6:25186053-25186075 TGCTGTGGTTCCAGTGCCACTGG + Intergenic
1005612506 6:27539821-27539843 TTCGGAAGTTGAGATGCCACTGG - Intergenic
1009188007 6:60596715-60596737 TTCAGACTTTCAAGTGCCACAGG + Intergenic
1010209952 6:73354574-73354596 TTCCGAGGTTCAGGTCCCACCGG - Intergenic
1010364969 6:75040428-75040450 TTGAGAGGTTCCTGTGCCACAGG + Intergenic
1019562871 7:1666815-1666837 TCCGGAGGTTCAAGCGGCGCGGG - Intergenic
1035738183 8:1904581-1904603 TTCGGAGGTTCAAGTGCCACAGG - Intronic
1039059965 8:33565616-33565638 TTTGGAGGTTCAGGTGATACTGG - Intronic
1049899855 9:149065-149087 TTTTGAGTTTGAAGTGCCACTGG - Intronic
1053742905 9:41159356-41159378 TTTTGAGTTTGAAGTGCCACTGG - Intronic
1054685438 9:68271944-68271966 TTTTGAGTTTGAAGTGCCACTGG + Intronic
1060075231 9:120584952-120584974 GGCGGAGGTTGCAGTGCCACTGG - Intergenic
1061506782 9:131036159-131036181 TTCCCAGGTGCAAGTGCAACGGG + Exonic
1186747416 X:12583857-12583879 TTCTGAGGTTCAGGCCCCACCGG - Intronic
1188366353 X:29320159-29320181 TTCTGTGGTTCAAGAACCACTGG + Intronic
1189304589 X:39977408-39977430 TTCCCAGGTTCAAGTGACTCTGG + Intergenic
1198443560 X:136688836-136688858 TTCGGAATTGCAAGTACCACAGG - Intronic