ID: 1035738188

View in Genome Browser
Species Human (GRCh38)
Location 8:1904597-1904619
Sequence CTCCGAATACACATGGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035738182_1035738188 -6 Left 1035738182 8:1904580-1904602 CCCTGTGGCACTTGAACCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG No data
1035738183_1035738188 -7 Left 1035738183 8:1904581-1904603 CCTGTGGCACTTGAACCTCCGAA 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035738188 Original CRISPR CTCCGAATACACATGGGGCA CGG Intronic
No off target data available for this crispr