ID: 1035740365

View in Genome Browser
Species Human (GRCh38)
Location 8:1923616-1923638
Sequence GAAACCTTCTTGGCCAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035740362_1035740365 14 Left 1035740362 8:1923579-1923601 CCCGGGAAGCAGGACAAGTTAGT 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1035740365 8:1923616-1923638 GAAACCTTCTTGGCCAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 133
1035740363_1035740365 13 Left 1035740363 8:1923580-1923602 CCGGGAAGCAGGACAAGTTAGTA 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1035740365 8:1923616-1923638 GAAACCTTCTTGGCCAATGCTGG 0: 1
1: 0
2: 0
3: 4
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035740365 Original CRISPR GAAACCTTCTTGGCCAATGC TGG Intronic
900075365 1:811702-811724 GTGACCTTCTTGGGCACTGCTGG + Intergenic
900566864 1:3337601-3337623 GAAGGCTGCTTGGCCACTGCGGG + Intronic
900686984 1:3954871-3954893 AAAACATCCTTGGCCAAAGCAGG - Intergenic
900756066 1:4435695-4435717 AAAACTTTATTGGCAAATGCAGG - Intergenic
906540408 1:46581309-46581331 GAGACCATCCTGGCCAATGTGGG + Intronic
907081707 1:51629579-51629601 GAAAACTTCTTGGCCTTTGGAGG + Intronic
908400841 1:63771741-63771763 GAAACCGCCTTGCCCAAAGCTGG - Intergenic
915376486 1:155400962-155400984 TTCACCTTCTTGGCCAAGGCTGG - Intronic
922271206 1:224036579-224036601 GTGACCTTCTTGGGCACTGCTGG + Intergenic
923338583 1:232990017-232990039 GAGACCTGCTTGGCCAGTGCAGG - Intronic
1062776542 10:153959-153981 AAACCCTTCTTGGCTAGTGCTGG - Intronic
1065005661 10:21377835-21377857 GAGACCATCCTGGCCAATACGGG - Intergenic
1065057801 10:21864418-21864440 GAGACCATCCTGGCTAATGCAGG + Intronic
1066793455 10:39092100-39092122 GAAACCATTGTGGCCAATGGGGG + Intergenic
1067279754 10:44862277-44862299 GCAACCTGCTTGGGCACTGCAGG + Intergenic
1069493056 10:68877964-68877986 GAATCCTTCTTCCCCAAGGCAGG - Intronic
1070344800 10:75531280-75531302 GAGAACTTGTTGGACAATGCAGG + Intronic
1070560077 10:77559549-77559571 GACACCTTCTTGCCCAGTGGAGG - Intronic
1072188037 10:93060782-93060804 TAACCCTTCTTGGCCCACGCTGG - Intergenic
1072748701 10:97960385-97960407 GAAACCCTCTTGGAAAATGAAGG + Intronic
1073470083 10:103716807-103716829 GCAGCCTTCTTGACCACTGCTGG - Intronic
1076794315 10:132791326-132791348 GAAACCTCCTTGGCCAGGCCAGG - Intergenic
1079028374 11:16966804-16966826 AAAACCTTCATGGCCAGAGCAGG - Intronic
1085416139 11:76320231-76320253 GAAACATTCCTGGCCTATGCAGG - Intergenic
1089649346 11:119902192-119902214 GAAACCTGCCTGGCCCAGGCAGG - Intergenic
1089909042 11:122077120-122077142 CAAAACATCTTGGACAATGCAGG + Intergenic
1092800823 12:12164426-12164448 GAAAGCCTCTGGGACAATGCAGG + Exonic
1093266122 12:17005826-17005848 GAATCTTTCTTGCCCAATACAGG - Intergenic
1093854267 12:24080545-24080567 GAAACTTTTATTGCCAATGCTGG + Intergenic
1094272304 12:28630233-28630255 GAAACCATTTTGGCCAAGGTGGG + Intergenic
1095062923 12:37723582-37723604 GAGACCTTTTTGGCCGATGGTGG + Intergenic
1095063166 12:37728549-37728571 GAACCCTTTGTGGCCAATGGTGG + Intergenic
1095131407 12:38547776-38547798 GAAACCTTCCTGGACATTGAGGG - Intergenic
1096388509 12:51211541-51211563 GATATCTTCCTGGGCAATGCAGG + Intronic
1096871152 12:54593026-54593048 GAGACCTTCCTGGCCAATATGGG - Intergenic
1097503108 12:60431572-60431594 GCAACCTTATTTTCCAATGCTGG + Intergenic
1103174519 12:118850946-118850968 GAGACCATCTTGGGCAATACAGG - Intergenic
1104993132 12:132637761-132637783 GGAACCTTCTTAGCAAAGGCAGG + Intronic
1108127762 13:47263112-47263134 GAAAAGTTCTTGGCCATAGCAGG - Intergenic
1109071814 13:57779059-57779081 GAAAGCTTCTTAACCCATGCAGG - Intergenic
1111972994 13:94936534-94936556 GAAAACTTCTTTTCCCATGCTGG + Intergenic
1112685435 13:101819657-101819679 GATACCTTCTTGTCTGATGCTGG - Intronic
1113640471 13:111953578-111953600 GGAACCTACTCGGCCAAGGCCGG - Intergenic
1115166336 14:30452429-30452451 GAATCCCTCTTCCCCAATGCAGG - Intergenic
1116062305 14:39939298-39939320 GAATCCTTCTTGGACCATGGAGG + Intergenic
1116585525 14:46698091-46698113 GAATCCTTCTTCCCCAAGGCAGG + Intergenic
1119105949 14:71923923-71923945 GAAACCTTCGTGATCTATGCAGG + Intergenic
1124909453 15:33904657-33904679 GAAACAGTCTCGGCCAAGGCAGG - Intronic
1125681511 15:41533627-41533649 GAAACCAGCCTGGCCAATACAGG + Intronic
1131533053 15:93211152-93211174 GAAACCTTCTTACCCGCTGCTGG + Intergenic
1134086727 16:11362411-11362433 GCAACCCTTTTGGTCAATGCTGG - Intronic
1135071514 16:19356203-19356225 GACACCATTCTGGCCAATGCAGG - Intergenic
1135501068 16:22996304-22996326 GAATCCTTCCTGGCCTCTGCTGG + Intergenic
1136916826 16:34212044-34212066 GAAACCTTTGTGGCCTATGGTGG - Intergenic
1138108836 16:54307213-54307235 GCAGCCATCTTGGCCATTGCAGG - Intergenic
1138191647 16:55018418-55018440 GAAACCAGCTTGGCCAATGTGGG + Intergenic
1139823123 16:69736379-69736401 GAAGCCTTCTCTCCCAATGCAGG + Intergenic
1145170210 17:20649818-20649840 AAATCCTTCTTGGCTAGTGCTGG + Intergenic
1149473694 17:56940931-56940953 GAGACCATCGTGGCCAACGCGGG + Intronic
1149631582 17:58129649-58129671 GAAACCATCTTGGACCATGAGGG + Intergenic
1150361437 17:64538332-64538354 GAAACCAGCTTGGCCAAACCTGG + Intronic
1155880271 18:31138825-31138847 GAAACCTTCTTGGATTAGGCAGG + Intronic
1157734111 18:50031203-50031225 AACAGCTTCTTGGCTAATGCAGG + Intronic
1161212656 19:3075609-3075631 GAAGCCGTCTTGGGCACTGCAGG - Intergenic
1162773197 19:12962743-12962765 GAGACCATCCTGGCTAATGCGGG - Intergenic
1163753774 19:19094401-19094423 GAACCCTTGATGGCCAAAGCTGG - Intronic
1164270797 19:23670002-23670024 GAAAACTTCTTGGCCCAGACTGG - Intronic
1165175783 19:33928919-33928941 GGCAACCTCTTGGCCAATGCTGG - Intergenic
1165621738 19:37253815-37253837 GAAACATTAGTGGCTAATGCTGG - Intergenic
1165633274 19:37319638-37319660 GAAACATTAGTGGCTAATGCTGG - Intronic
925531791 2:4871561-4871583 GAACACTTCTTTCCCAATGCAGG + Intergenic
927361057 2:22234392-22234414 GAGACCTTCGTGGAGAATGCTGG + Intergenic
928685512 2:33745277-33745299 GAGACCATCCTGGCTAATGCGGG + Intergenic
929222035 2:39474891-39474913 GAGACCAGCTTGGCCAAAGCTGG + Intergenic
930318707 2:49827908-49827930 GATACCTTCCTTGCCAGTGCAGG + Intergenic
931125591 2:59272881-59272903 GAAAGCTTCTGGGCCCATCCCGG + Intergenic
946204205 2:218091713-218091735 TAAGCCTTCTTGGACAATACAGG - Intergenic
948067507 2:235092194-235092216 GCCACCTTCTAGGCAAATGCCGG - Intergenic
949082358 2:242113093-242113115 GTGACCTTCTTGGGCACTGCTGG - Intergenic
1170450098 20:16474094-16474116 AAGTCCTTCTTGCCCAATGCAGG + Intronic
1171739015 20:28837634-28837656 GAGACCTTTTTGGCCTATGGTGG + Intergenic
1171933459 20:31249454-31249476 GAAACCTTATAGGCTAAAGCTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173629129 20:44496997-44497019 GAAAGCTTCTAGGTCCATGCTGG - Intronic
1176964067 21:15192392-15192414 GAAGCCTTCTTGGAGATTGCAGG + Intergenic
949109052 3:236509-236531 GACACATTTTTGGCCAGTGCAGG - Intronic
949583231 3:5412012-5412034 GAAAGCTGCTTGGCCAGGGCTGG - Intergenic
951366393 3:21788277-21788299 GAGACCAGCCTGGCCAATGCGGG + Intronic
952264559 3:31772945-31772967 AAACCCTTCTTGGCTAGTGCTGG - Intronic
955930731 3:64054280-64054302 GGAACCTTCTTGGGCAAATCAGG + Intergenic
956520478 3:70098213-70098235 CAAACCTTCTTGGGAAATGTAGG + Intergenic
958718286 3:97814019-97814041 GAAACCTTAGAGGCCATTGCAGG + Intergenic
962477414 3:135767552-135767574 GAACCCTGATTGGCCAAAGCAGG - Intergenic
975147758 4:70989214-70989236 GAGACCTGCCTGGCCAATGTGGG + Intronic
975648884 4:76572489-76572511 GAAACCTTAGTGGTCAATGATGG + Intronic
976388507 4:84485475-84485497 GAAACCATCATGGCCCTTGCAGG + Intergenic
979904648 4:126271492-126271514 AAATCCTTCTTGGCTAATGCTGG - Intergenic
982326202 4:154130682-154130704 GAAACCATTGTGGCTAATGCGGG - Intergenic
986279889 5:6314369-6314391 GAAACCACCTTGTCCAATGGGGG + Intergenic
987038261 5:14038867-14038889 GAAACCTTCCTGGCCCCTCCAGG + Intergenic
989398520 5:40984217-40984239 GTAACCTTCTTTCCCAGTGCAGG + Intergenic
990856042 5:60267608-60267630 GAAAGCACCTTGGCCAGTGCTGG + Intronic
990954298 5:61328608-61328630 GAAACCTTGCAGGACAATGCTGG + Intergenic
991413229 5:66365909-66365931 GAAATCCTCTTGGCCATAGCTGG - Intergenic
993007584 5:82444936-82444958 GAGACCTTCATAGCAAATGCAGG + Intergenic
995098136 5:108264012-108264034 GAGACCAACCTGGCCAATGCTGG + Intronic
995239197 5:109866469-109866491 TAAAGCTTCTTGGCCATTGGAGG + Intronic
1000021685 5:157323726-157323748 AAAACCTTCATGGCCAACCCGGG - Intronic
1000301582 5:159961509-159961531 GAAACCTTCTTTTACAAAGCTGG + Intronic
1001420586 5:171583427-171583449 GGAAGCTTCTGGGCCCATGCAGG + Intergenic
1002841556 6:911113-911135 GAAACCTTTAGGGCCAATGAAGG - Intergenic
1003212830 6:4082440-4082462 GAATCCCTCTTCTCCAATGCAGG + Intronic
1003321327 6:5054618-5054640 GAATCCTTCTTGGCCAAGAGAGG - Intergenic
1011126256 6:84011193-84011215 GAAACCTTCTTGGCCAGGTGCGG + Intergenic
1013091561 6:106905102-106905124 GAATCCTTCTTTCCCAAGGCAGG + Intergenic
1014862004 6:126480356-126480378 GAAAGTTTCTTAACCAATGCTGG + Intergenic
1016843226 6:148544705-148544727 GAGACCTTCCTGGTCAAAGCCGG - Exonic
1017115669 6:150974298-150974320 CAATCCTTCTTGGCCACTCCTGG + Intronic
1019649688 7:2150145-2150167 GTAGCCTCCTTGGCCAATGTCGG - Intronic
1024522815 7:50321616-50321638 GAGACCCCTTTGGCCAATGCAGG + Intronic
1024674298 7:51624149-51624171 GAAGCCTTCCTGGCCATTCCAGG - Intergenic
1032621887 7:133542582-133542604 GAATCCCTCTTGCCCAAGGCTGG - Intronic
1035540278 8:429819-429841 GTGACCTTCTTGGGCACTGCTGG - Intronic
1035740365 8:1923616-1923638 GAAACCTTCTTGGCCAATGCTGG + Intronic
1036956114 8:13190267-13190289 GCTACCCTCTTGGCCATTGCAGG + Intronic
1037040941 8:14232274-14232296 TAAACCTTCTTGGACAAAGAAGG + Intronic
1045462129 8:102434410-102434432 GAGACCAGCTTGGCCAATGTGGG + Intergenic
1046340696 8:112851187-112851209 GAGATCTTCTTGGCAAATGAAGG + Intronic
1046708788 8:117486803-117486825 GATACCTTGTTTGCCAGTGCAGG - Intergenic
1048722933 8:137347712-137347734 GAGACCATCCTGGCTAATGCAGG - Intergenic
1054934921 9:70676859-70676881 GAAACCGTCTTCCCCAAGGCAGG + Intronic
1057906300 9:98986065-98986087 GGAATCTTCATGGGCAATGCAGG + Exonic
1186218616 X:7326059-7326081 GAATCCCTCTTCCCCAATGCAGG - Intronic
1186583138 X:10842431-10842453 GAAAACGTATTGGCCACTGCAGG - Intergenic
1187044268 X:15630656-15630678 TAAAACTTCTGGCCCAATGCTGG + Intronic
1187822226 X:23300016-23300038 GAAACCTTTTTTTCCAATTCTGG - Intergenic
1190940017 X:55031057-55031079 GATACCTTTGGGGCCAATGCAGG - Exonic
1191568481 X:62572689-62572711 GAGACCTTCACGGCCAATGGTGG + Intergenic