ID: 1035741009

View in Genome Browser
Species Human (GRCh38)
Location 8:1928743-1928765
Sequence GACTCAGGAGTAGCCCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035741006_1035741009 -1 Left 1035741006 8:1928721-1928743 CCTGGAAAGAGTCCTTGACTTTG 0: 1
1: 0
2: 1
3: 20
4: 208
Right 1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 92
1035741003_1035741009 26 Left 1035741003 8:1928694-1928716 CCATGGAGGGCGTGGTGGGGAGC 0: 1
1: 0
2: 4
3: 31
4: 274
Right 1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 92
1035741005_1035741009 4 Left 1035741005 8:1928716-1928738 CCTGTCCTGGAAAGAGTCCTTGA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 92
1035741002_1035741009 27 Left 1035741002 8:1928693-1928715 CCCATGGAGGGCGTGGTGGGGAG 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035741009 Original CRISPR GACTCAGGAGTAGCCCGTGC AGG Intronic
900086305 1:899381-899403 CACTTAGGAGTATTCCGTGCAGG - Intergenic
903759620 1:25688908-25688930 GTCTCAGGAGTAGCCTTGGCAGG + Intronic
904841136 1:33372682-33372704 GATGCAGGAGCAGGCCGTGCTGG - Intronic
906251304 1:44312869-44312891 GACTCTGGGGTAGCCTATGCTGG - Intronic
913250677 1:116910114-116910136 GACTCTGGAGCAGCCGGAGCTGG + Exonic
916717619 1:167458386-167458408 GACTCAGGCCTAGCCCCTGCTGG + Intronic
919972842 1:202591942-202591964 GTCTCAGGAGATGCCCATGCTGG - Exonic
922241064 1:223755795-223755817 GGCTCAGGAGTAGCCCCCGTAGG + Intronic
924380909 1:243463508-243463530 GACACAGGAGCAGCCCTGGCTGG - Intronic
1062890683 10:1057215-1057237 GGCGCAGGAGTAGTCCGTGGCGG + Intronic
1067292824 10:44956790-44956812 GAGTCTGGAGTAGGCAGTGCAGG + Intergenic
1069531523 10:69222982-69223004 GTCTCAGTAGTAACCCTTGCAGG - Intronic
1072410897 10:95201188-95201210 GACTCAGGAGGTGCATGTGCAGG + Intronic
1074087795 10:110221841-110221863 GACTCAGGTGCTGCCCGAGCTGG - Intronic
1074293368 10:112158629-112158651 AGCTCAGGAGTACCCCTTGCAGG - Intronic
1076242755 10:128922154-128922176 GACACAAGAGCAGCCCTTGCTGG + Intergenic
1076658339 10:132038919-132038941 GGCTCAGGAGAAGCCCGGGATGG + Intergenic
1077030255 11:462285-462307 CACTCAGGAGAGGCCAGTGCTGG - Intronic
1084150874 11:67287390-67287412 GACTCATGAGTGGCCCAGGCTGG + Intergenic
1085339522 11:75722136-75722158 GACCCAGGAGTGGGCCCTGCAGG - Intronic
1085526293 11:77166198-77166220 GACTCAGGCCTGGCCCGTGGGGG - Intronic
1088892735 11:114058150-114058172 GAGTCAGGAGTGGCTCTTGCTGG + Intergenic
1089261670 11:117227971-117227993 GAGTAAGGAGTGGCCCCTGCAGG - Intronic
1090273414 11:125403622-125403644 GGCTCTGGAGTAGCCCATCCCGG - Intronic
1096550026 12:52366057-52366079 GACACAGGAGGAGCCTGTGAAGG + Intronic
1102649576 12:114429661-114429683 GACTCAGGAGGTACCTGTGCAGG - Intergenic
1104076573 12:125395012-125395034 GACTCAGGAGGTACCTGTGCAGG - Intronic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1113441850 13:110335208-110335230 AACTCAGGAGTCGCCTGTGTTGG - Intronic
1131191481 15:90320278-90320300 GACTCTGGATTAGCTAGTGCGGG - Intergenic
1133850664 16:9500358-9500380 CACTCAGGAGTAGCTCCTACTGG + Intergenic
1134712280 16:16333029-16333051 GACTCGGGAGCAACCCCTGCTGG - Intergenic
1136608592 16:31352844-31352866 GACCCAGGAGTGGGCCATGCTGG - Intergenic
1138233703 16:55361324-55361346 GACTTAGGAGTTGACAGTGCTGG + Intergenic
1141907466 16:87036830-87036852 GACTCAGGTGAAGCAGGTGCCGG - Intergenic
1147858461 17:43501286-43501308 GCCTGAGGAGTAGCCCGTGTTGG + Intronic
1161063334 19:2226121-2226143 GCCTCATGGGTAGCCCGGGCAGG + Intronic
1163521643 19:17795276-17795298 GGCTCTGGAGAAGCCCCTGCCGG + Intronic
1164011391 19:21206047-21206069 GTCTCAGGAGAGGCCAGTGCGGG - Intergenic
1165358592 19:35319400-35319422 GGCTCTGGAGTGGCCAGTGCTGG - Intronic
925082813 2:1082991-1083013 GACACAGCAGCAGCCCCTGCAGG + Intronic
927999035 2:27507100-27507122 GAGTGAGGAGTAGCCCTTGTGGG - Intronic
929928268 2:46232859-46232881 GACTGAGGAGGAGCTGGTGCAGG - Intergenic
931881658 2:66576226-66576248 GACTCAGGGGTAGCACGTCCTGG - Intergenic
934562010 2:95318235-95318257 GACTCAGGACAAGCCTGGGCTGG + Intronic
937011940 2:118570997-118571019 GACTCAGGAGAAGCCCTAGGGGG - Intergenic
937490599 2:122363232-122363254 CACTCAGGAATAACCAGTGCAGG - Intergenic
939958711 2:148547702-148547724 GACCCAGAAGTAGCCCTTGAAGG + Intergenic
944692778 2:202172707-202172729 AAGTGAGGAGTAGCCAGTGCTGG + Intronic
945674015 2:212833357-212833379 GACTCAGTAGTAGCCAGACCTGG + Intergenic
946809506 2:223508509-223508531 GGGTCAGGAGAAGCCAGTGCTGG + Intergenic
947376679 2:229503310-229503332 GACTGAGGAGAGGCCCTTGCTGG + Intronic
1169092896 20:2872355-2872377 GACTCAGGGGTTGCCCGGTCTGG + Intronic
1171183946 20:23111579-23111601 GCCTGAGCAGCAGCCCGTGCAGG - Intergenic
1171313673 20:24167094-24167116 CACTCAGCAGTAGCCCTGGCAGG + Intergenic
1176429640 21:6567872-6567894 GCCTCAGGAGCTGCCTGTGCTGG + Intergenic
1179705034 21:43175334-43175356 GCCTCAGGAGCTGCCTGTGCTGG + Intergenic
1184883055 22:47324006-47324028 GCCTCAGGAGCATCCCTTGCAGG + Intergenic
955765752 3:62342575-62342597 GACTGAGGAGTTGTCAGTGCTGG - Intergenic
961465274 3:127077440-127077462 CACGCAGGAACAGCCCGTGCGGG - Intergenic
964596675 3:158440092-158440114 GACACATGAGTAGAACGTGCAGG - Intronic
969444202 4:7234877-7234899 GACTCAGGGGCAGGCAGTGCTGG + Intronic
970419163 4:15889004-15889026 GACTCAGGAATAAACCCTGCTGG + Intergenic
971537221 4:27768235-27768257 GATTGAGGAGTAGCCCATGTTGG + Intergenic
985357163 4:189133659-189133681 GATTCAGGAGTTACACGTGCAGG - Intergenic
990615871 5:57507779-57507801 TATGCATGAGTAGCCCGTGCCGG - Intergenic
992499468 5:77327705-77327727 GACTGGGAAGTAGCCTGTGCTGG + Intronic
994980772 5:106873851-106873873 TAGTCAGGAGTAGGCCGAGCTGG - Intergenic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
998443813 5:142183406-142183428 GCCTCAGGAGTAGCCACTGTGGG + Intergenic
1000460693 5:161513755-161513777 GATTCAGGAGGTGCACGTGCAGG - Intronic
1004902805 6:20209803-20209825 GCCACAGGAGGAGCCCCTGCAGG + Intronic
1005714525 6:28534272-28534294 TACTCAGGTGGAGCCCATGCAGG - Exonic
1007516810 6:42419262-42419284 GACTCAGCAGAAGCCGGGGCGGG - Intronic
1013262638 6:108461486-108461508 GGCTCAGTAGTAGCCCAGGCTGG + Intronic
1017673280 6:156788085-156788107 GACTCAGGACAAGCCCTTGCTGG + Intronic
1017941819 6:159060180-159060202 AACTCAGGAGTAGGCCAAGCTGG + Intergenic
1018154516 6:160973359-160973381 GTCTCAGGAGAAGGCTGTGCGGG + Intergenic
1018857775 6:167687792-167687814 GACTCAGGAGTCACCTGTGCAGG + Intergenic
1024242379 7:47445503-47445525 GATTCAGGGGCAGCCTGTGCAGG - Intronic
1026206801 7:68264718-68264740 GACTCAGAAATACCCCGTGATGG - Intergenic
1026598161 7:71751848-71751870 GACTCAGGGGCAGCATGTGCAGG + Intergenic
1028479418 7:91288424-91288446 AACTCAGGAGTGCCCCCTGCTGG - Intergenic
1031148551 7:118025779-118025801 GACTCAGGTATAGACAGTGCTGG + Intergenic
1031949298 7:127875430-127875452 GGCTAAGGAGTAGCCTGTTCAGG + Intronic
1033111702 7:138584745-138584767 GATTCAGAAGTAGCCAATGCTGG + Exonic
1035741009 8:1928743-1928765 GACTCAGGAGTAGCCCGTGCAGG + Intronic
1039921605 8:41897244-41897266 GGCTCGGGAGTAGCGCGTCCGGG - Intergenic
1047509923 8:125508224-125508246 GAGTAAGGAGTACCACGTGCAGG - Intergenic
1053198626 9:36137851-36137873 GACTCAGGAGATGCCAGCGCTGG + Intronic
1053368774 9:37543077-37543099 GACTCAGCAGTAGTCTGTCCTGG - Intronic
1059942336 9:119369896-119369918 GTCTCGGGAGTTGCCCGTGTGGG + Intergenic
1060206446 9:121685297-121685319 GACTCAGGAGTTGTCCGGGGTGG + Intronic
1061356658 9:130110695-130110717 GTCTCAGGAATGGCCTGTGCTGG + Intronic
1061793105 9:133068876-133068898 GACTCAGGGGCGACCCGTGCGGG + Intronic
1061795708 9:133084660-133084682 GACTCAGGGGCGACCCGTGCGGG + Intronic
1199540361 X:148952064-148952086 GACTGATGAGGAGCCTGTGCTGG + Intronic