ID: 1035741496

View in Genome Browser
Species Human (GRCh38)
Location 8:1931183-1931205
Sequence TGGTAGGAACACAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 348}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035741496_1035741501 10 Left 1035741496 8:1931183-1931205 CCCTGCTGCCTGTGTTCCTACCA 0: 1
1: 0
2: 1
3: 32
4: 348
Right 1035741501 8:1931216-1931238 AACTCTTTCATGAAGCTTCGTGG No data
1035741496_1035741503 29 Left 1035741496 8:1931183-1931205 CCCTGCTGCCTGTGTTCCTACCA 0: 1
1: 0
2: 1
3: 32
4: 348
Right 1035741503 8:1931235-1931257 GTGGAGGAATGTGTGTTGATAGG No data
1035741496_1035741502 13 Left 1035741496 8:1931183-1931205 CCCTGCTGCCTGTGTTCCTACCA 0: 1
1: 0
2: 1
3: 32
4: 348
Right 1035741502 8:1931219-1931241 TCTTTCATGAAGCTTCGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035741496 Original CRISPR TGGTAGGAACACAGGCAGCA GGG (reversed) Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
901668250 1:10838582-10838604 TTCTAGGAACAAAGGCAGCACGG + Intergenic
902553888 1:17235448-17235470 CGGTAGGACCTCAGGCAGGAGGG + Intronic
902751095 1:18511664-18511686 TTGTGGGAGCACAGGAAGCATGG + Intergenic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
903715286 1:25361285-25361307 TGGAAGGGACACAGGGAGCCTGG - Exonic
903837028 1:26211073-26211095 TGGTGGGAAGACAGGCAGCTGGG + Intergenic
904895545 1:33814792-33814814 TGCTGGGAACACAGGCAGTGGGG - Intronic
905027418 1:34860247-34860269 TGGCAGGCACACAGCCAGCAGGG + Intergenic
905037253 1:34926284-34926306 TGGTAGGAAGAGATGCTGCATGG + Intronic
905792021 1:40794875-40794897 TGGTAGGGACAGAGGGATCAGGG + Intronic
906790200 1:48652498-48652520 TGGTGGACACACAGGCAGCAGGG + Intronic
907302742 1:53498725-53498747 TGCCAGGAACACAGGCTCCACGG - Intergenic
907456931 1:54581991-54582013 GGGCTGGAGCACAGGCAGCAGGG - Intronic
908955349 1:69618887-69618909 TGTTTGGAACACAGGTGGCAAGG - Intronic
909161640 1:72158394-72158416 TGGCAGGCTCACAGGTAGCAGGG + Intronic
909679063 1:78270993-78271015 TGGTTGGAACAGAGCGAGCAAGG - Intergenic
909992670 1:82241821-82241843 TAGGAGAAACACAGGCAGAATGG + Intergenic
910098543 1:83551783-83551805 GGGTAGGATCACAGCCAGCCTGG + Intergenic
910560496 1:88584777-88584799 TGAAAGGAAGACAGGCAGGAAGG + Intergenic
910720042 1:90275676-90275698 AGGTAAGAATCCAGGCAGCAAGG + Intergenic
910963717 1:92786847-92786869 TGGCTGGAGCACAGACAGCAGGG - Intronic
912322676 1:108728830-108728852 TGGCCGAAACACAGGCAGGACGG + Exonic
915049265 1:153050092-153050114 TGCCAGGAGCAGAGGCAGCATGG - Intergenic
915418690 1:155762409-155762431 TGGGAAGAACACAGGTTGCAGGG - Intronic
916443196 1:164847370-164847392 GGGCAGGAAGTCAGGCAGCAGGG + Exonic
917771883 1:178288500-178288522 TGGAATGAACACAAGCAGAAGGG - Intronic
918722865 1:187876266-187876288 TAGTAGGAACACAGCTTGCATGG - Intergenic
919894805 1:202002887-202002909 GGGTAGGAACCCAGGCAGCCTGG + Intronic
920293664 1:204942371-204942393 TGGCTGGAACACAGGATGCAAGG + Intronic
920373391 1:205493386-205493408 TGGGAGGAACACAGCCTGCCCGG + Intergenic
922656473 1:227388825-227388847 TGGTTGGAGCACAGGCAGGAAGG + Intergenic
922890200 1:229056024-229056046 AGGTAGGAAGACAGGCAGGTAGG + Intergenic
923167169 1:231376910-231376932 TGGCTGGAACACAGCGAGCACGG + Intronic
1063352950 10:5373474-5373496 TTGTTAGAACACAGGCAGCTGGG + Intronic
1065359938 10:24879995-24880017 TGGCCGGAACCCAGGCAGCCTGG - Intronic
1065622299 10:27594684-27594706 TGTTGGGAACAGAGGCTGCAAGG - Intergenic
1067392881 10:45881422-45881444 TGATAGGAACCAAGACAGCAAGG + Intergenic
1067850386 10:49750579-49750601 TGCTAGGGACAGAGGCAACATGG + Intronic
1067861203 10:49850545-49850567 TGATAGGAACCAAGACAGCAAGG + Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1070896220 10:79984519-79984541 TGGGAGGGGCACAGGCAGCAAGG + Intergenic
1071569952 10:86691343-86691365 TGGTAAGAAACAAGGCAGCAAGG - Intronic
1072222333 10:93336946-93336968 AGGTAGGAAGACAGGCAGGCAGG + Intronic
1072574188 10:96685362-96685384 TGGGAGGAGCAGAGGCAGCCAGG + Intronic
1072717810 10:97763094-97763116 TGTGAAGAACACAGGCAGCCAGG - Intergenic
1072742065 10:97915484-97915506 TGGGAGGAAAGCAGGCAGAAGGG - Intronic
1074773512 10:116749003-116749025 AGGTAGGAAAGCAGACAGCAGGG - Intergenic
1074936846 10:118190407-118190429 AGGAAGGAACTAAGGCAGCATGG + Intergenic
1075815938 10:125264918-125264940 TGGAGGGATCACAGGCAGCTGGG + Intergenic
1076428918 10:130388115-130388137 TGGTTGGTACACAGCCAGCCAGG - Intergenic
1076740123 10:132478710-132478732 TGGCAGGAACCCGGGCTGCATGG + Intergenic
1076893411 10:133296281-133296303 TGCTGGGATCCCAGGCAGCAGGG + Intronic
1077797756 11:5509231-5509253 GGGTAGGGACAGAGGCAGCTGGG + Exonic
1079163997 11:18020465-18020487 TGCTAGCAACAAAGACAGCAGGG + Exonic
1079472864 11:20796805-20796827 TAGGAGGAATACAGGGAGCAAGG + Intronic
1080733503 11:34985565-34985587 AGGCAAGAACACAGGCAGTAGGG + Intronic
1081606776 11:44532061-44532083 TGGTAGAAACAGAGGCTCCAAGG - Intergenic
1082276058 11:50222700-50222722 TGGTAGGAACAGCAGCATCAAGG + Intergenic
1082764030 11:57152368-57152390 TGTTAGGAACACAAGCTGTAGGG + Intergenic
1083104834 11:60347679-60347701 TGCTGGGACCACAGGAAGCAAGG - Intronic
1083652125 11:64209771-64209793 TGGGAGGAACTCAGGAAACAGGG + Intronic
1084092309 11:66886646-66886668 TGGGAGGCAGAGAGGCAGCAGGG + Intronic
1084685848 11:70694801-70694823 TGGAAGGAGGGCAGGCAGCATGG - Intronic
1084685853 11:70694821-70694843 TGGAAGGAGAGCAGGCAGCATGG - Intronic
1084937733 11:72595996-72596018 TGGGCGGAAGACAGGCAGCTAGG - Intronic
1085237444 11:75025893-75025915 TGGAAGGAACACAGGCCACTTGG + Intergenic
1087061220 11:93979728-93979750 TGGCTAGAACATAGGCAGCATGG + Intergenic
1087113586 11:94498355-94498377 TGCTGGGAACAGAGACAGCAAGG + Exonic
1087377339 11:97360997-97361019 GGTTAGGAACACAGACAGAAAGG + Intergenic
1087396731 11:97609855-97609877 TGGTATGAACCCATGAAGCAGGG + Intergenic
1087798660 11:102480795-102480817 TTGTAAGAGAACAGGCAGCATGG - Intronic
1089525944 11:119096611-119096633 GGCTAGGAACACAGGCTCCACGG - Exonic
1089982069 11:122780726-122780748 TGGCAGGAGCACAGGCAGGCAGG + Intronic
1091642302 12:2246657-2246679 TGGTGAGAACCCAGCCAGCATGG + Intronic
1091680124 12:2521220-2521242 TGGTAGGAACAGAGGCTGTGTGG + Intronic
1092290527 12:7157398-7157420 GGGTAGGAAAAGAGGCAGCCCGG - Intronic
1092994917 12:13940717-13940739 TGGTAGAAAAAAAGGGAGCAGGG + Intronic
1093065345 12:14652557-14652579 TGGAAGGAAGGCAGGCAGAAGGG + Intronic
1093473926 12:19534193-19534215 TGGCTGGAACACAGCCAGCGAGG + Intronic
1094026227 12:25962024-25962046 TGGTAGTAAAACAGACTGCAAGG - Intronic
1094042850 12:26135417-26135439 TGGTAGGCACAGAGGAGGCAAGG + Intronic
1096039603 12:48501671-48501693 AGGTAGGAAAACAGGCAAAAAGG - Intergenic
1096797060 12:54084538-54084560 AGGGAGGAACACAGTCAGAAAGG - Intergenic
1097622561 12:61958454-61958476 TGGTAGGAATACAGGGAAAAAGG - Intronic
1097812975 12:64038039-64038061 TGGTGGGAACCCAGACAGCCTGG - Intronic
1098192865 12:67968627-67968649 TGGTAGAATAACAGGCAGTAGGG - Intergenic
1098227892 12:68343401-68343423 AGGTAGGAAGACAGGAAGAAGGG + Intergenic
1100011208 12:89955576-89955598 TTCTTGGCACACAGGCAGCAGGG + Intergenic
1101816582 12:108150573-108150595 TGGTAGGAACACAGCATGCCTGG + Intronic
1102222897 12:111206479-111206501 TGACAGGAACACAGAGAGCAAGG - Intronic
1102478043 12:113201546-113201568 TGCGATGAACACAGGCTGCAGGG + Intronic
1102913705 12:116737667-116737689 GGGTAGGAAGACAGGGAGGAAGG + Intronic
1103342517 12:120228678-120228700 TGGGAGGAACACAGGTAGCCTGG + Intronic
1104992636 12:132634764-132634786 TGGCACGAACACAGGCTGCGCGG - Intronic
1105623487 13:22091024-22091046 TGGTAGGATGACAGGGAGGATGG + Intergenic
1106075694 13:26459198-26459220 TAGTGGGAACTCAGGCACCATGG + Intergenic
1106413489 13:29526934-29526956 TGGCAGGGTCACAGTCAGCAGGG - Intronic
1107312360 13:39092980-39093002 TGGTTGGAACACAGGATGCTTGG + Intergenic
1108729582 13:53220403-53220425 CGGTAGAAACACTGCCAGCATGG - Intergenic
1110784986 13:79513127-79513149 TGGTTGGTACCCAGCCAGCATGG - Intronic
1111021580 13:82458472-82458494 TGGTTGGAACCCAGGAAGTATGG - Intergenic
1112199436 13:97260784-97260806 TGGCTGGAACACAGGCAGTTTGG - Intronic
1112412515 13:99176587-99176609 TTGTTGGAACACAGCCAGCGTGG + Intergenic
1113408412 13:110062838-110062860 TGGAAGGAGCAGTGGCAGCAAGG - Intergenic
1117065106 14:52005642-52005664 TGGCAGTGTCACAGGCAGCAGGG + Exonic
1117625225 14:57629743-57629765 AGACAGGAACACAGGAAGCAGGG + Intronic
1118010422 14:61605105-61605127 AGGAAAGAACACAGGCAGAATGG - Intronic
1118221652 14:63859980-63860002 TGGTAGGAACGAAGGAAGGAAGG - Intronic
1118715498 14:68556843-68556865 TGGTAGGAAACAAGGCAGGAAGG - Intronic
1118848696 14:69568420-69568442 TGGTAAGAACACATCCACCATGG + Intergenic
1119643151 14:76329735-76329757 TGGCAGGAACAACGGCAGGACGG - Intronic
1119804872 14:77476010-77476032 GGGTAGGCACACGGGCAGCTGGG + Exonic
1120423493 14:84316963-84316985 ATGTAGGAACACAGGAAACATGG + Intergenic
1123663505 15:22587184-22587206 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124317335 15:28681636-28681658 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124566108 15:30815867-30815889 TGTTATGACCAGAGGCAGCAAGG - Intergenic
1125008712 15:34847171-34847193 TGCTGGGATTACAGGCAGCAGGG - Intergenic
1128260062 15:66227116-66227138 AGGTAGTAACACTGACAGCATGG + Intronic
1128379965 15:67105303-67105325 TGGTGGGGACTCAGGCAGGATGG + Intronic
1128463378 15:67888349-67888371 TGGAAGGGACACAGGGAGCAAGG + Intergenic
1128809326 15:70559306-70559328 AGGACGGAACACAGGCAGCCTGG - Intergenic
1130147009 15:81282119-81282141 TGGCAGGGACACAGCCTGCATGG - Intronic
1131543945 15:93299893-93299915 TGGCTGGAACACTGACAGCAGGG - Intergenic
1131581250 15:93645891-93645913 TGCTGGGAACCCAGGCTGCAGGG - Intergenic
1133317157 16:4892011-4892033 TGGGTGGCAGACAGGCAGCATGG - Intronic
1137289215 16:47040322-47040344 AGGTAGGTACTCAGGCAGGAGGG + Intergenic
1142147997 16:88500424-88500446 TGGTGGGAACAAGGGCAGCTGGG - Intronic
1142909266 17:3073014-3073036 TGTGAGAATCACAGGCAGCAGGG + Intergenic
1142925294 17:3231224-3231246 TGTGAGAATCACAGGCAGCAGGG - Intergenic
1143480525 17:7225296-7225318 TGGGAGGGAGGCAGGCAGCAGGG - Intergenic
1144539110 17:16121858-16121880 TGGTACAAACCCAGGCAGCCTGG - Intronic
1144659779 17:17060463-17060485 TGGAAGCAAAACAGGCACCAAGG - Intronic
1144782811 17:17816400-17816422 TGGGTGGAGCACAGGCAGCAGGG + Intronic
1145812462 17:27772668-27772690 AGGTTGGAACAATGGCAGCAGGG + Intronic
1146617911 17:34371305-34371327 TGGGTGGAACACAGACTGCAGGG - Intergenic
1150231339 17:63552842-63552864 TGACAGGCACACAGGTAGCATGG + Intronic
1150508209 17:65720527-65720549 TGGTAAAGACAGAGGCAGCAAGG + Intronic
1151148100 17:72059972-72059994 TGGTGGGAACACTGACACCATGG + Intergenic
1151344736 17:73494700-73494722 TGGGAGGGAGAGAGGCAGCAGGG - Intronic
1151571378 17:74927516-74927538 TGGTAGGAACACAGCCTGGCTGG - Intronic
1152074187 17:78148709-78148731 TGGCCAGAACACAGGAAGCAAGG + Intronic
1153934036 18:9904910-9904932 TCGTAGAAACAGAGGCTGCAGGG - Intergenic
1153972587 18:10239811-10239833 TGGAAGATACACAGCCAGCATGG - Intergenic
1154399332 18:14020381-14020403 TTTTAGGAAGACAGGCAGGAAGG - Intergenic
1156198415 18:34802533-34802555 TGGCATTAACACAGGAAGCAAGG - Intronic
1158250889 18:55486323-55486345 TGCTGGGATTACAGGCAGCATGG - Intronic
1158812659 18:61055828-61055850 TAGCAGAAACACAGGCACCATGG + Intergenic
1161043403 19:2121908-2121930 TGGGACGGACACAGGCAGCAGGG + Intronic
1163325887 19:16603051-16603073 TCTTAGGAACTTAGGCAGCAGGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163813225 19:19447681-19447703 AGGGAGGATCACAGCCAGCAGGG - Intronic
1165141636 19:33703341-33703363 TGTTCCTAACACAGGCAGCAGGG + Intronic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1166732279 19:45065726-45065748 TGGTAGGAGCATAGACTGCAGGG + Intronic
1167491040 19:49792750-49792772 TGGCAGGACCCCAGGCAGCTGGG - Intronic
925552556 2:5092198-5092220 TGTGAGGAACAAAAGCAGCATGG - Intergenic
925875540 2:8308475-8308497 TGGTGGGAAATCAGGCAGCACGG + Intergenic
926090783 2:10047883-10047905 TGGTGGGAAAGCAGGCAGCAGGG - Exonic
926355704 2:12038939-12038961 TGGTCGGATCAGAGGCAGCAGGG + Intergenic
927744831 2:25609025-25609047 TGTTTGGAGCACAAGCAGCAAGG + Intronic
929746594 2:44665852-44665874 GGGTAAGAACACTGGCAGCAGGG + Intronic
929955520 2:46455315-46455337 TTGTAGGAATCCAGGCAGCTTGG - Intronic
930813020 2:55561819-55561841 TTATAGGATCACAGGCAGAAGGG + Intronic
934588369 2:95525894-95525916 TGGTGGAAACACAGGCTGCCAGG + Intergenic
934658579 2:96130930-96130952 AGGTGGGAACTCAGGAAGCAGGG - Intronic
935331461 2:101980459-101980481 TGGCAGGAACAAGGTCAGCACGG + Intergenic
935381902 2:102461347-102461369 TGGTGGGCAGACATGCAGCATGG + Intergenic
935606218 2:104974496-104974518 TGGAAGGCACAGAGGCTGCATGG - Intergenic
935661607 2:105471536-105471558 GGGTATGAACACAGGAAGGAAGG - Intergenic
936001694 2:108837960-108837982 TGGTAGGAAGACAGGAGTCAAGG + Intronic
936095956 2:109530202-109530224 TGGTGGGAACACAAAAAGCATGG + Intergenic
936510272 2:113139552-113139574 TGGTTGGAGCACAGGGAGCTAGG + Intergenic
937150964 2:119685349-119685371 TGGTGGGGACTGAGGCAGCAGGG - Intronic
938578990 2:132629172-132629194 GGCTTGGAAGACAGGCAGCAGGG + Intronic
938662204 2:133498574-133498596 TGGTAGGGAGACAGGGAGAAGGG + Intronic
939998231 2:148940367-148940389 TGCTAGGGATACAGGCAGCCAGG + Intronic
941810055 2:169746543-169746565 TGCTAGGAGCACAGTGAGCAAGG + Intronic
943013367 2:182479529-182479551 AGGAAGGAAGACAGGCAGGAAGG + Intronic
943665776 2:190606935-190606957 AGGTAGGAAGCCAGGCACCAAGG - Intergenic
943954072 2:194163329-194163351 AGGTAGGAAAACAGGAAGGAAGG + Intergenic
946021873 2:216645843-216645865 TGGTAGAACCACAGGCACAATGG - Intronic
947425641 2:229980741-229980763 CAGCAGGAACACAGCCAGCAGGG - Intronic
947665161 2:231900784-231900806 TGGTGGGGACCCAAGCAGCACGG + Intergenic
948663223 2:239519466-239519488 TGACAGCAAGACAGGCAGCATGG - Intergenic
1168758482 20:332353-332375 TGGGAGGAAAAGAGGCATCAAGG - Intergenic
1168797289 20:620154-620176 TGGTAGGAAAGCACACAGCAGGG - Intergenic
1168853027 20:989581-989603 TGGCAGGAACACAGGGAGTTGGG + Intronic
1170445045 20:16417744-16417766 TGGTAGGCTCAAAGGCAGAATGG + Intronic
1171848916 20:30294395-30294417 AGGGAGGAACACAGTCAGAAAGG - Intergenic
1174184299 20:48694817-48694839 GGGTTGGAGCACAGGCAGAATGG + Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1175171038 20:57081734-57081756 AGGCAGGATCACAGACAGCAAGG + Intergenic
1175893381 20:62325122-62325144 GGGCAGGCAGACAGGCAGCAGGG + Intronic
1176151766 20:63595165-63595187 TGGCAGGAATACCTGCAGCAAGG + Intronic
1176326638 21:5507446-5507468 GGGAAGAAGCACAGGCAGCAGGG + Intergenic
1176331069 21:5548763-5548785 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176396688 21:6272188-6272210 GGAAAGGAGCACAGGCAGCAGGG + Intergenic
1176401119 21:6313505-6313527 GGGAAGAAGCACAGGCAGCAGGG - Intergenic
1176436038 21:6675599-6675621 GGGAAGAAGCACAGGCAGCAGGG + Intergenic
1176440469 21:6716916-6716938 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176460300 21:7002669-7002691 GGGAAGAAGCACAGGCAGCAGGG + Intergenic
1176464731 21:7043985-7044007 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1176483861 21:7384447-7384469 GGGAAGAAGCACAGGCAGCAGGG + Intergenic
1176488292 21:7425764-7425786 GGAAAGGAGCACAGGCAGCAGGG - Intergenic
1177629755 21:23711288-23711310 TGGGAGGATCACAGGAACCAGGG + Intergenic
1178125819 21:29514562-29514584 TGGTAGAAACATCGGCAGCTTGG + Intronic
1178580272 21:33832165-33832187 TGTCATGAACAAAGGCAGCAAGG - Intronic
1178721544 21:35014983-35015005 TGGTAGGAACTGAGGAAACAAGG + Intronic
1180839200 22:18950958-18950980 TGTTCCAAACACAGGCAGCAGGG + Intergenic
1181439989 22:22930801-22930823 TGGGGAGACCACAGGCAGCAGGG + Intergenic
1183205660 22:36417230-36417252 AGCCAGGGACACAGGCAGCAAGG + Intergenic
1184101038 22:42341903-42341925 TGGGAGGACCACAGGGAGGAGGG + Intronic
1184196123 22:42929911-42929933 TGAGAGGAACACAGGCAGGCAGG - Intronic
1185117324 22:48945230-48945252 TGTGAGGATCACAGGGAGCAGGG + Intergenic
1185267280 22:49911005-49911027 TGGCAGGAACACAGGCTCCCAGG + Intronic
949346032 3:3077681-3077703 TCGCTTGAACACAGGCAGCAGGG + Intronic
949621726 3:5820417-5820439 AGGCAGGAACAAAGCCAGCAGGG + Intergenic
950368693 3:12508489-12508511 AGTCAGGAACACAGGCAGAATGG + Intronic
953071963 3:39529759-39529781 AGCGAGGAACACAGGAAGCAGGG + Intergenic
953215346 3:40913051-40913073 TGGAAGAAACTCAAGCAGCATGG + Intergenic
953277553 3:41517715-41517737 TGGTGAGGGCACAGGCAGCAAGG + Intronic
953918512 3:46936019-46936041 GGGCAGGAACACAGGCAGGCAGG + Intronic
955581215 3:60425082-60425104 TGGTAGAAACACATGGATCAAGG + Intronic
957735436 3:84196604-84196626 TGGTAGGAATGCAGGCTGCTAGG - Intergenic
959496909 3:107062106-107062128 GGGCAGGAATACAGGCAGCAAGG - Intergenic
959501652 3:107113682-107113704 TGGAAGGAAAAGAGGCAGAAGGG + Intergenic
960854301 3:122086922-122086944 TGAAAGAAACACAGGCTGCATGG + Intronic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
963101779 3:141614211-141614233 TGGTATGATCACAGGGACCAAGG + Exonic
965987224 3:174769850-174769872 TAGTAAGAAAACAGGCAACAGGG - Intronic
966289941 3:178343630-178343652 TGGTGGGCACAGAGCCAGCAAGG + Intergenic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
968331950 3:197878403-197878425 TGGTAGGAACAGGGGCAGGCTGG - Intronic
968816632 4:2824860-2824882 TGGCTGGGACACAGGCAGCTGGG + Intronic
969339464 4:6531096-6531118 TGGTGGCACCAAAGGCAGCAAGG + Intronic
970017273 4:11526065-11526087 TGGTGGGATTACAGGCTGCAAGG - Intergenic
970170087 4:13280710-13280732 TGGAAGCAAAAGAGGCAGCAAGG - Intergenic
970647991 4:18145338-18145360 TGGCAGGAAGGCAGGCAGGAAGG - Intergenic
970671961 4:18406879-18406901 TGGTAGAAAAACACGGAGCAAGG + Intergenic
973560239 4:52128166-52128188 GGGGAGGAACTCAGGCAGGAGGG + Intergenic
973656040 4:53048771-53048793 TTGGAGGAATGCAGGCAGCATGG - Intronic
973656223 4:53050816-53050838 TTGGAGGAATGCAGGCAGCATGG - Intronic
976825528 4:89256423-89256445 TGTTATGAAAATAGGCAGCATGG - Intronic
976994710 4:91416123-91416145 GGGTAGGAATACAGGTAACAAGG + Intronic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
978859733 4:113434046-113434068 TGGTAGGAATTCATGCAACAAGG - Intergenic
980088940 4:128421371-128421393 TGGTGGAAACAGAGGCAGCAAGG + Intergenic
980993333 4:139757741-139757763 TGGTAGGATCAGAGGTAGCATGG - Intronic
981412732 4:144451880-144451902 TGAAAGGAACACAGCCAACACGG + Intergenic
981480140 4:145229975-145229997 TGGGAGGAAGACAGGCAAGAGGG - Intergenic
981760295 4:148187299-148187321 TGGTGGGAATACAGCCACCATGG - Intronic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
982207216 4:153005767-153005789 AGCTGGGAACACACGCAGCAGGG + Intergenic
983435959 4:167715774-167715796 TGGTAGGAATAAAGGAAGGAAGG + Intergenic
983766442 4:171490011-171490033 TTGCAGGAGCACAGGCAGAAAGG + Intergenic
983979308 4:173974169-173974191 TGGGAGGGAGACAGGCATCATGG + Intergenic
984916135 4:184726546-184726568 TGGTGGGAACACAGGCACTGTGG + Intronic
985201790 4:187491564-187491586 TTGTAGGAACACGCACAGCAAGG + Intergenic
985872001 5:2564391-2564413 TGGTGGTAACGCAGGGAGCACGG + Intergenic
985951864 5:3228269-3228291 TGGAAGGAACACCTGCAGAACGG - Intergenic
987119565 5:14754061-14754083 TGGCAGGAACTCAAGCAACAAGG + Intronic
988113332 5:26852009-26852031 TGGGAGGAACACAGGATTCAGGG + Intergenic
988992826 5:36688423-36688445 TGGAAGGATCCCATGCAGCAAGG + Intergenic
990034230 5:51300113-51300135 TGGTAGGAACACAGAAAGTTAGG - Intergenic
992917257 5:81469806-81469828 TGCTAGCAACAAAGGCAGAATGG + Intronic
993213137 5:84980280-84980302 TGATAGGAAAACATGCAGCTGGG - Intergenic
994010887 5:94900861-94900883 TTGTAAGAACACAGGAATCATGG + Intronic
994357457 5:98810023-98810045 TGGGAGGATCACAGGAAGCCAGG - Intergenic
994949697 5:106444778-106444800 TGGTAGGAAAATAGGGAGAATGG + Intergenic
995542122 5:113195800-113195822 TATTTGGAACACAGGCAGAAGGG - Intronic
995991214 5:118241877-118241899 TGGTCAGAACACAGGGAGCAGGG - Intergenic
996045955 5:118873661-118873683 TGGTGGGCACACAGCCAGCATGG + Intronic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996774374 5:127118246-127118268 TGGTAGGAAAAGATTCAGCATGG + Intergenic
997800703 5:136858168-136858190 TGCTGGGAACAGAGACAGCAAGG + Intergenic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
1000716698 5:164653254-164653276 TGGTAGGAATACACAAAGCATGG - Intergenic
1000941186 5:167362132-167362154 TGTTTGGAACACAGGAAGCAAGG + Intronic
1001692679 5:173644529-173644551 TGGGAGTGACACAGGCATCAAGG + Intergenic
1002089187 5:176794465-176794487 TGGTGGGGACAGAGGAAGCAGGG - Intergenic
1003568418 6:7239899-7239921 TGGGAGGGACACAGCCACCAAGG + Intronic
1004543462 6:16573777-16573799 TTGTAGGCACAGTGGCAGCAGGG - Intronic
1005620304 6:27614088-27614110 TGGGAGGAACACAGGCTGTCAGG - Intergenic
1006598174 6:35208734-35208756 TGGAAGGACAAGAGGCAGCAGGG + Intergenic
1006731263 6:36237942-36237964 TGGTAGTTACACTTGCAGCAGGG - Intergenic
1007514293 6:42399066-42399088 TGGAAGGAAGTCAGGCAGCATGG + Intronic
1007971851 6:46059771-46059793 TGGGAGGCAGACTGGCAGCATGG - Intronic
1008456593 6:51717796-51717818 TGGAAGGGACACAGGCATGAAGG + Intronic
1008576855 6:52869089-52869111 TGGGAGGAACACAGGCTCCCTGG - Intronic
1008767406 6:54935523-54935545 TGGTAGGACCACATTAAGCAAGG + Intronic
1010090266 6:71972421-71972443 TGGTAGAGAGACAGGAAGCAGGG + Intronic
1010456680 6:76064205-76064227 TGGTAGGCACATAGCCAGCAGGG - Intronic
1010953044 6:82059585-82059607 TGGTGGGAAGACAGGCTGTAAGG - Intergenic
1012323877 6:97888963-97888985 TGGAAGGAACAAAGGGAGAAAGG - Intergenic
1012367631 6:98461710-98461732 TGGCAGGAACACATGCTGTATGG + Intergenic
1012492271 6:99795380-99795402 TGGAAGGAAAACTGGAAGCAGGG - Intergenic
1013480593 6:110549627-110549649 TGGTGGGGACACAGGTAGGAAGG + Intergenic
1014676819 6:124378003-124378025 TGGTATCCACACAGCCAGCAGGG - Intronic
1015881871 6:137878511-137878533 TGGCAGGAAAACAGCGAGCAGGG + Exonic
1016967033 6:149728723-149728745 CGGTTGGAGCTCAGGCAGCAGGG - Intronic
1017077536 6:150632596-150632618 TGGCAGGAACACATGCAGGCTGG + Intronic
1017757106 6:157539004-157539026 TGGTAGGAACGGCGGAAGCATGG + Intronic
1018057840 6:160067863-160067885 TGCTAGGAGCACACACAGCAGGG - Intronic
1018176454 6:161182570-161182592 TGCCAGGGACACATGCAGCATGG - Intronic
1018813528 6:167314761-167314783 AGGTAGGAAGACTGGAAGCAGGG - Intronic
1019562958 7:1667077-1667099 TGGGAGGAAAGCAGGCGGCAGGG - Intergenic
1019640041 7:2098472-2098494 TGGTGGGACCCCAGGCAGCAGGG - Intronic
1019994963 7:4718053-4718075 TGGTGGGAACACGGGCAACAGGG - Intronic
1020246158 7:6431088-6431110 TTATAGGAACACAGCAAGCACGG + Intronic
1021166504 7:17349149-17349171 TGTTGGGAAAACTGGCAGCATGG - Intergenic
1022359960 7:29648505-29648527 TGGGAGGGGCACAGGCAGCAAGG - Intergenic
1022368768 7:29751173-29751195 TAGGAGGGGCACAGGCAGCAAGG - Intergenic
1022607256 7:31827825-31827847 TGGAAGGAAGACAGGAAACAAGG + Intronic
1025854788 7:65267404-65267426 GGGAAGGAGCACAGGCAGCAGGG - Intergenic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1028961262 7:96751914-96751936 TGCAGGGACCACAGGCAGCAGGG + Intergenic
1029160569 7:98548775-98548797 AGGTAGGTAGACAGGCAGGAAGG - Intergenic
1030187454 7:106777819-106777841 TGCTAGGAAGAGAGGAAGCAGGG + Intergenic
1031240880 7:119237811-119237833 TGGTAGGAGCAAAAGCATCATGG + Intergenic
1031870222 7:127082912-127082934 GGATCGGAACCCAGGCAGCATGG + Intronic
1033224522 7:139550086-139550108 TTCTAGGATCACAGACAGCATGG - Intergenic
1033763865 7:144466046-144466068 GCGTAGGGACACAGGCAGCAGGG - Intronic
1034514811 7:151567527-151567549 TAATAGGAACAGAGGGAGCATGG - Intronic
1035451127 7:158977517-158977539 AGTTAGGAACACAGGCAGGGTGG + Intergenic
1035521434 8:277630-277652 TGGTGAGGACACAGGCAGAAGGG + Intergenic
1035682770 8:1500513-1500535 TGGTAGAAACCAAGGCAGCCTGG + Intergenic
1035694386 8:1583933-1583955 TGGAAGGATGACCGGCAGCAAGG - Intronic
1035741496 8:1931183-1931205 TGGTAGGAACACAGGCAGCAGGG - Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1036771747 8:11583202-11583224 TTTTAGGAACACACTCAGCAGGG - Intergenic
1037835494 8:22212758-22212780 CGGCAGGAAGACAGGCACCAGGG - Intergenic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038695176 8:29799947-29799969 TGCTGTGAACACAGGCAGGAAGG - Intergenic
1039178781 8:34839866-34839888 TTGTAGGAAAACAGGGAGCAAGG - Intergenic
1039314470 8:36356393-36356415 AGGCAGGAACACAGGAAGGAAGG + Intergenic
1040325814 8:46340955-46340977 TGGGAGGGCCACAGGCATCAGGG + Intergenic
1040447066 8:47506186-47506208 TGGAAGTAACACAGGGAGGAGGG + Intronic
1041326082 8:56666111-56666133 AGGGAGGAAGACAGGCAGGAAGG - Intergenic
1042544047 8:69935044-69935066 TGGTAGGAAGCCAGGCTACATGG + Intergenic
1043499635 8:80839786-80839808 AGGCAGGAAGACAGGCAGGAAGG - Intronic
1044837888 8:96313732-96313754 AGGTGGGATCACAGGCAGCGAGG - Intronic
1044977188 8:97676165-97676187 TGGGAGGAACACATGCATCCAGG - Intronic
1046742396 8:117843516-117843538 TAGCAGGAACAAAGGCACCAAGG + Intronic
1047915845 8:129582978-129583000 TGGGAGGAGCACAGTGAGCAAGG + Intergenic
1048138452 8:131769682-131769704 AGCTAGGAACACAGAAAGCAAGG - Intergenic
1048514151 8:135090606-135090628 TGGTAGAAACTCAGACATCAGGG + Intergenic
1048840155 8:138558552-138558574 TGGTGGGAGCAGAGACAGCAAGG - Intergenic
1048860832 8:138723684-138723706 TGGGAGGAACACTGGCTGAATGG - Intronic
1048901919 8:139046998-139047020 AGGCAGGAAGACAGGCAGGAAGG - Intergenic
1049327899 8:142033319-142033341 GGGCAGGGACTCAGGCAGCAGGG + Intergenic
1049593848 8:143474515-143474537 TGCTAGGAACACAGCCAGGCAGG + Intronic
1049685187 8:143936542-143936564 TGGCAGGACGACAGGCAGCTAGG - Intronic
1049685706 8:143938521-143938543 AGGTGAGCACACAGGCAGCATGG + Intronic
1052337845 9:27337941-27337963 CTCTAGGACCACAGGCAGCATGG - Intronic
1055315036 9:75026565-75026587 TAGTAGTAACAGAGGGAGCAAGG - Intronic
1058805081 9:108582743-108582765 TGGTAGGAACACTGTGAGGAAGG - Intergenic
1059406601 9:114102144-114102166 TGGTTGGAACACAGTTAGCAAGG + Intergenic
1059410203 9:114127051-114127073 TGGCTGGGACACAGGCATCAGGG + Intergenic
1059494674 9:114699794-114699816 TGGTAGTGACACAGGCAGGAGGG + Intergenic
1060449040 9:123720011-123720033 TGGTCGGTACTTAGGCAGCATGG - Intronic
1060612203 9:124977579-124977601 TGGTAGGATCACTTGCACCAGGG + Intronic
1060654364 9:125358891-125358913 TGGAAGGAACACGAGCAGCCAGG + Intronic
1061561254 9:131405325-131405347 TTGGAAGAAAACAGGCAGCAAGG - Intronic
1062158514 9:135067178-135067200 CGGTAGGGACACAGGCAGAGGGG + Intergenic
1062240388 9:135534489-135534511 GGGAAGGAACAGAGGAAGCAGGG - Intergenic
1062370383 9:136235753-136235775 TGGTGGCTACAGAGGCAGCATGG + Intronic
1203431033 Un_GL000195v1:91563-91585 GGAAAGGAGCACAGGCAGCAGGG + Intergenic
1203435479 Un_GL000195v1:133061-133083 GGGAAGAAGCACAGGCAGCAGGG - Intergenic
1185693367 X:2174920-2174942 TGGTAGGGACAGACACAGCAGGG + Intergenic
1187529048 X:20080088-20080110 TTGTAGAAACACAGGAAGCTAGG - Intronic
1187649193 X:21381724-21381746 TGGTAGGCAAACAGGAAGGACGG - Intronic
1188727804 X:33607167-33607189 TGGGAGGGAGACAGGGAGCAGGG - Intergenic
1190032568 X:46988628-46988650 GGCTGGGAACCCAGGCAGCAAGG + Intronic
1195419187 X:104654494-104654516 TGGCTGGAGCATAGGCAGCAAGG + Intronic
1197731207 X:129811616-129811638 TTGAAGAAACACATGCAGCATGG + Intronic
1197938727 X:131766421-131766443 TGGTGTGAACCCAGGAAGCAGGG + Intergenic
1198041585 X:132858443-132858465 TGTTAGGAACACAGGAGGTAAGG - Intronic
1198746273 X:139893793-139893815 TGGAAGGAACATAGGCATCTGGG - Intronic
1199981216 X:152921471-152921493 TGGCAGGAATACAGAGAGCAGGG + Intronic
1201304527 Y:12539198-12539220 AGGTAGGATGCCAGGCAGCAGGG + Intergenic