ID: 1035744146

View in Genome Browser
Species Human (GRCh38)
Location 8:1949786-1949808
Sequence GGAGCCACAGCCTTTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035744141_1035744146 20 Left 1035744141 8:1949743-1949765 CCGGACTCAAGATGGTGAGTTAA 0: 1
1: 0
2: 0
3: 13
4: 91
Right 1035744146 8:1949786-1949808 GGAGCCACAGCCTTTCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035744146 Original CRISPR GGAGCCACAGCCTTTCTCGG TGG Intronic
No off target data available for this crispr