ID: 1035745350

View in Genome Browser
Species Human (GRCh38)
Location 8:1958686-1958708
Sequence CAACCTCGGGGGGCTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035745338_1035745350 8 Left 1035745338 8:1958655-1958677 CCTCTTTTCTGTGTCAAGTGGAA 0: 1
1: 0
2: 2
3: 11
4: 230
Right 1035745350 8:1958686-1958708 CAACCTCGGGGGGCTGGGTGGGG 0: 1
1: 0
2: 0
3: 26
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035745350 Original CRISPR CAACCTCGGGGGGCTGGGTG GGG Intergenic
900922931 1:5685135-5685157 GAACCTTGTGGGGCTGGGTAGGG + Intergenic
901069102 1:6508435-6508457 CTGCATCGGGAGGCTGGGTGGGG - Intronic
901200982 1:7467333-7467355 CAACCAGGGGGGACAGGGTGGGG - Intronic
901651095 1:10743659-10743681 CAAAATGGGGGGGCGGGGTGCGG + Intronic
902725723 1:18334839-18334861 CTTCATCGTGGGGCTGGGTGAGG - Intronic
905026967 1:34857232-34857254 CAAGCCCGGGGGGTGGGGTGGGG + Intronic
905275957 1:36818450-36818472 CAACCTGGGGAGGCTGGGAGTGG - Intronic
906090125 1:43172018-43172040 CGAGCTCGTGGGGCTGGGCGTGG - Intronic
906204461 1:43979534-43979556 GAATCTCGGGGCCCTGGGTGGGG - Intronic
907245102 1:53103418-53103440 CGACCTCGGGCGGCGGGGTCAGG + Exonic
910719109 1:90266035-90266057 GAAGCTTGAGGGGCTGGGTGCGG + Intergenic
912478313 1:109957351-109957373 CAAACTTGGGGGGGTGAGTGAGG - Intergenic
914766818 1:150644810-150644832 AAAACTCCGGTGGCTGGGTGTGG - Intergenic
917974934 1:180232519-180232541 CCACCCTGGGGGGGTGGGTGTGG - Intronic
919755190 1:201062150-201062172 CATCCTCTGGGCCCTGGGTGGGG + Intronic
920453321 1:206077479-206077501 CAACATGGTGAGGCTGGGTGTGG + Intronic
921706637 1:218329108-218329130 AAACCTGGGTTGGCTGGGTGTGG + Intronic
922566322 1:226604078-226604100 CAAACTCTGGGGGCTGTGTGGGG - Exonic
923015777 1:230125954-230125976 CAACCTCTGAGCACTGGGTGGGG - Intronic
923118625 1:230968982-230969004 AAAGCTTAGGGGGCTGGGTGCGG + Intronic
924589794 1:245392878-245392900 AAATTTTGGGGGGCTGGGTGCGG + Intronic
1063381940 10:5591055-5591077 CAGCCTGGAGGGCCTGGGTGAGG - Intergenic
1063411014 10:5836489-5836511 AAACCTCTAGAGGCTGGGTGTGG - Intronic
1065025245 10:21534565-21534587 CGGGCTCGGGGGGCTGTGTGGGG + Intronic
1066081733 10:31937668-31937690 AAACCTCTTGTGGCTGGGTGTGG - Intergenic
1066576101 10:36826621-36826643 TAACCTAATGGGGCTGGGTGTGG + Intergenic
1067218775 10:44326346-44326368 CCACCTTGGGTGGCTGGGAGGGG + Intergenic
1068740461 10:60463192-60463214 GAACCTAGGGAGGCTGGGTGTGG - Intronic
1070485943 10:76931630-76931652 CAACCTCTGGGGTTTGGTTGTGG - Intronic
1070765424 10:79053511-79053533 CAGACTCGGGGGGCGGGGGGCGG + Intergenic
1071809250 10:89160793-89160815 AAACCTTTGGGGCCTGGGTGGGG + Intergenic
1073318130 10:102597214-102597236 CATCCTCGGGGGGCCGGCTCAGG - Exonic
1073511433 10:104045195-104045217 CATCCTCGGGGGTCTGACTGGGG - Intronic
1074316542 10:112366626-112366648 AAAACATGGGGGGCTGGGTGCGG + Intergenic
1074874358 10:117602649-117602671 CAACCTCAGGTGGCTTGGAGGGG + Intergenic
1075084857 10:119407871-119407893 AAAACTTGGGGGGCTGGGTGTGG + Intronic
1075486808 10:122829207-122829229 CAAACTAGAGGGGCGGGGTGGGG - Intergenic
1076768073 10:132647675-132647697 CAGCCGCGAGGGTCTGGGTGGGG - Intronic
1076835554 10:133019387-133019409 CATCCTCGTGGGGATGGGGGTGG + Intergenic
1077006149 11:358249-358271 CCACGTCGAGGGGCTGGGAGGGG - Intergenic
1077016217 11:400148-400170 CAGCCTCGGGCAGCGGGGTGGGG + Intronic
1077365381 11:2159414-2159436 GAACCTGGGAGGGCTAGGTGGGG + Intronic
1079083246 11:17428393-17428415 CAACCCTGAGGGGCTGGGGGTGG + Exonic
1079219070 11:18543179-18543201 TAACCTCTCTGGGCTGGGTGTGG - Intronic
1080638894 11:34147076-34147098 TCACCTCGAGGGGCTTGGTGTGG + Intronic
1081630815 11:44688462-44688484 CAACCTCCTGGGGCAGGGAGGGG - Intergenic
1082147094 11:48683568-48683590 CCACCTCTCGGGGCAGGGTGAGG + Intergenic
1083292406 11:61697266-61697288 CAAGCTCAGGAGGCTGGGTAGGG - Intronic
1083718500 11:64592451-64592473 CAACCTCTGGGAGAGGGGTGAGG + Intronic
1084557459 11:69883517-69883539 CCACCACGGGATGCTGGGTGTGG + Intergenic
1084591615 11:70093853-70093875 CAACCTCGGGGCTCCGAGTGCGG + Intronic
1087046869 11:93850236-93850258 CTTCCTCGTGGGGCTGGGCGAGG - Intronic
1087753029 11:102026282-102026304 CAATATCAGGGGGCTGGGTGTGG - Intergenic
1088417782 11:109608446-109608468 GAACCTCTGGGGCCAGGGTGGGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1088613033 11:111597252-111597274 CAGGAGCGGGGGGCTGGGTGGGG - Intergenic
1088642311 11:111884858-111884880 AAATCTTGGTGGGCTGGGTGCGG + Exonic
1088894036 11:114064458-114064480 CAAGCTGGGGGAGCTGGCTGTGG + Exonic
1089280440 11:117370618-117370640 AAAGCTGGGTGGGCTGGGTGTGG + Intronic
1089484075 11:118831301-118831323 CCACGTTTGGGGGCTGGGTGCGG - Intergenic
1090238611 11:125166481-125166503 CAGCCTCGCGGGGCTGGGAGTGG + Intronic
1094809953 12:34126957-34126979 CAACCTAGAGTGGCTGGGGGTGG - Intergenic
1095930936 12:47624445-47624467 CAAGCTTGGTGGGCTGGGGGCGG + Intergenic
1096113058 12:49040338-49040360 CAACTTCAGGGGGCTGGGGTCGG + Exonic
1096551437 12:52375989-52376011 CATCCTCAGGGTGCTGGCTGGGG + Intergenic
1096557859 12:52414691-52414713 GGACCTCAGAGGGCTGGGTGTGG - Intergenic
1096869788 12:54586066-54586088 CATCCTGGAGGGGCAGGGTGTGG + Intronic
1097186277 12:57198179-57198201 CAACCCCGATGGGCTGGCTGTGG + Exonic
1097662555 12:62446620-62446642 CTACCACTGGGGGCTGGGTGTGG - Intergenic
1097779003 12:63682042-63682064 TATACTCGGGGGGCGGGGTGAGG + Intergenic
1099444466 12:82735633-82735655 AAAATTAGGGGGGCTGGGTGCGG - Intronic
1099478236 12:83134598-83134620 CAACTTCGGGGGGAGGGTTGGGG + Exonic
1100607002 12:96159905-96159927 CCACCTTGGGGGGTTGGTTGGGG - Intergenic
1100827897 12:98491975-98491997 AAACGTCTGGTGGCTGGGTGCGG - Intronic
1101324868 12:103706629-103706651 GACCCTCTGGGGACTGGGTGAGG - Intronic
1102164337 12:110794755-110794777 CAACCCCGGGCTGCTGGGTTGGG - Intergenic
1102967336 12:117138214-117138236 CAATTTCGGGGGGCGGGGGGTGG + Intergenic
1103775604 12:123364615-123364637 CACCCTCGGGGGGCCGTGCGGGG - Intronic
1106284258 13:28305495-28305517 CTACCATGAGGGGCTGGGTGTGG - Intronic
1106541782 13:30696968-30696990 CATCCTGGGGGCCCTGGGTGAGG + Intergenic
1106814266 13:33389246-33389268 TAACCTCAAGAGGCTGGGTGCGG - Intergenic
1113841917 13:113365305-113365327 CAAGACCGGGGGGCGGGGTGGGG + Intergenic
1113882723 13:113636717-113636739 CAACCTGGCGTGGCTGTGTGAGG + Intronic
1115555129 14:34539521-34539543 AATCCTCGGGGGCCAGGGTGGGG + Intronic
1116835244 14:49763869-49763891 AAACTCCAGGGGGCTGGGTGTGG - Intergenic
1118267487 14:64308931-64308953 GAAACTGAGGGGGCTGGGTGTGG - Intronic
1118712606 14:68534740-68534762 CAATCTAGGGGGGGTGGGAGCGG - Intronic
1118877669 14:69798311-69798333 GAACCTAGGAGGCCTGGGTGGGG + Intergenic
1119740553 14:77011305-77011327 CAAGCTAGGGGGTCTGGGAGTGG - Intergenic
1120850571 14:89165305-89165327 CTACCTTGTGGGGCTGCGTGAGG + Intronic
1121640549 14:95482014-95482036 AAAGCTCAGGGTGCTGGGTGGGG + Intergenic
1121644266 14:95507156-95507178 GAAGCTCAGGGGGCTGGGCGGGG - Intergenic
1121841994 14:97142333-97142355 CAACCTCAGGGTCCTGGGAGAGG - Intergenic
1122623660 14:103073597-103073619 CAGCCTGGGTTGGCTGGGTGGGG - Intergenic
1124343386 15:28904320-28904342 CAAACTCGTATGGCTGGGTGTGG - Intronic
1124348746 15:28940220-28940242 AAGCCTCGGGAGGCTGGGCGTGG + Intronic
1124624484 15:31300234-31300256 CAGGCTCTGGGGCCTGGGTGGGG - Intergenic
1124632914 15:31347465-31347487 CACCCTCAGGGGGCTGGGCTGGG + Intronic
1127975878 15:63996972-63996994 CAAGCCTGGAGGGCTGGGTGGGG + Intronic
1128647297 15:69387107-69387129 AAGCCTCCAGGGGCTGGGTGAGG - Intronic
1129573535 15:76715777-76715799 TGACCTTGGGGGGCAGGGTGAGG - Intronic
1130394477 15:83490127-83490149 CAACCTCAGGGGGATGGATGAGG + Intronic
1130740639 15:86596006-86596028 CAATCTTAGGGGGTTGGGTGTGG + Intronic
1131353394 15:91722046-91722068 CAACCTGTGGGGGCTGGGGTGGG - Intergenic
1132607553 16:799915-799937 GAACCTTGGGAGGGTGGGTGGGG + Intronic
1132691199 16:1182633-1182655 CCACATCGGGGGCCTGGCTGGGG + Intronic
1132748139 16:1445477-1445499 CCTCCGTGGGGGGCTGGGTGCGG - Exonic
1134517579 16:14899430-14899452 CAGCCTCGTGGGGAGGGGTGAGG + Intronic
1134640728 16:15827512-15827534 CAGCCTGGTGGGGCTGGGAGTGG + Intronic
1134705247 16:16298081-16298103 CAGCCTCGTGGGGAGGGGTGAGG + Intergenic
1134962294 16:18414033-18414055 CAGCCTCGTGGGGAGGGGTGAGG - Intergenic
1134966591 16:18496632-18496654 CAGCCTCGTGGGGAGGGGTGAGG - Intronic
1135175143 16:20221343-20221365 CAAGCTTCGGGGGCTGGGGGAGG - Intergenic
1135671276 16:24377684-24377706 CAGCCTCTGGGGGCTGAGTCAGG - Intergenic
1136387657 16:29939714-29939736 CAACGTTGGGGGACTGAGTGTGG - Intergenic
1136487965 16:30585401-30585423 CCACCTGGGCGCGCTGGGTGAGG - Exonic
1136574989 16:31117979-31118001 CAAGATCCGGGGGCTGGGAGTGG + Intronic
1137560472 16:49499079-49499101 AAACCTCGGCTTGCTGGGTGGGG - Intronic
1139597822 16:67968478-67968500 CAACCTCGAGGGGCTCAGTTGGG - Exonic
1139614951 16:68083343-68083365 CAACCTTGAGGGCCTGAGTGTGG - Intergenic
1139731403 16:68948894-68948916 CAATCCTGGGTGGCTGGGTGCGG + Intronic
1141130866 16:81435706-81435728 CAACAGCGGGGGGTTGGGGGTGG - Intergenic
1141301159 16:82816797-82816819 AAACTTCGGGGGGCGGGGGGTGG + Intronic
1141614893 16:85204820-85204842 CACCCTTGGCTGGCTGGGTGTGG - Intergenic
1141751544 16:85961721-85961743 GAAGCTCGGGGGGCGGGGGGCGG - Intergenic
1142547533 17:715030-715052 CAACCTCGGGGTCCTCAGTGCGG - Intronic
1142808478 17:2384364-2384386 CCACCTCTGGGGGTTGGGGGTGG + Exonic
1142848807 17:2694623-2694645 CAGCGTTGGGGAGCTGGGTGGGG - Intronic
1142905274 17:3037067-3037089 CAGCCTGGTGGGGCTGGCTGGGG + Exonic
1143666375 17:8364157-8364179 AAATATTGGGGGGCTGGGTGCGG - Intergenic
1144482557 17:15639796-15639818 CCACTTGGGGGGCCTGGGTGGGG - Intronic
1144916126 17:18725235-18725257 CCACTTGGGGGGCCTGGGTGGGG + Intronic
1145262912 17:21365372-21365394 CAGCCTTGGGTGTCTGGGTGGGG - Intergenic
1145970003 17:28951003-28951025 CAACCCCGGGGGGAGGGGGGAGG + Exonic
1146445062 17:32927141-32927163 CCACCTCTGTGGGCTGGATGTGG + Intergenic
1146840843 17:36153110-36153132 CAACATCTGGGGGCTGGGGCAGG + Intergenic
1147291047 17:39443288-39443310 ATACCTGGGGAGGCTGGGTGCGG - Intronic
1147446122 17:40476212-40476234 CAGCTTCTGGAGGCTGGGTGGGG + Exonic
1148322756 17:46767390-46767412 CAACCTCAGGGAGGTGGGTGGGG - Intronic
1148745470 17:49915742-49915764 CACCCTCCTGGGGATGGGTGTGG - Intergenic
1148908554 17:50927292-50927314 CCACATCTTGGGGCTGGGTGCGG - Intergenic
1152376274 17:79920348-79920370 CCTTCTCCGGGGGCTGGGTGAGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1153128230 18:1822396-1822418 CAACATTTGGGGCCTGGGTGGGG + Intergenic
1153560614 18:6368749-6368771 CAACGTCTGGAGGCTGGGTGTGG + Intronic
1157514619 18:48302035-48302057 AGACATCGTGGGGCTGGGTGTGG - Intronic
1157688676 18:49663643-49663665 CCACCTCTAGGGCCTGGGTGTGG + Intergenic
1159212497 18:65343776-65343798 GCACCTCTGGGTGCTGGGTGAGG - Intergenic
1160665762 19:327438-327460 CCAGCTCTGGTGGCTGGGTGTGG - Intronic
1160809143 19:1005559-1005581 CGGCCTCGGGGGGCTGCGGGTGG + Intronic
1160862846 19:1244974-1244996 CAGGCTCGAGGGGGTGGGTGGGG + Intergenic
1160902419 19:1435005-1435027 CAACCTTGGGGGGGGGGGCGGGG + Exonic
1160934928 19:1590015-1590037 AAACCACTGGGGGCCGGGTGTGG + Intronic
1161156077 19:2732486-2732508 CAACCTCGGGCCGTGGGGTGTGG - Intronic
1161301376 19:3544568-3544590 CCACCCCCGGGAGCTGGGTGAGG + Exonic
1161620688 19:5295433-5295455 CACCCCCGAGGGGCTGGGGGAGG + Intronic
1162145613 19:8610939-8610961 GAACCGCGGGGGGCGGGGAGGGG + Intergenic
1162425698 19:10594155-10594177 CAGCCTCAGGGGGATGGGGGAGG - Intergenic
1163154516 19:15432579-15432601 CGGGCTCGGGGGGCTGGGCGGGG + Intronic
1163250658 19:16124712-16124734 CAAGCACGGGGGGCGGGGGGGGG - Intronic
1164656156 19:29923514-29923536 CAGCCCCAGGGTGCTGGGTGAGG + Intergenic
1165143424 19:33716656-33716678 CAAAATCAGGTGGCTGGGTGTGG - Intronic
1165474454 19:36022301-36022323 CCACCTTAGGGGGCTGGTTGAGG - Intronic
1165757855 19:38304570-38304592 CAACTTCAGGGGGCTGGGTAAGG + Intronic
1165819657 19:38666351-38666373 CAACCGATGGGGGCTGGGGGTGG + Intronic
1165829325 19:38722697-38722719 CACCCTCGGGGGTGTGGGGGTGG + Intronic
1166253093 19:41584832-41584854 CAGCCTGGACGGGCTGGGTGGGG + Intronic
1166902864 19:46079553-46079575 GAAACTCGGGTGGCTGGCTGGGG - Intergenic
1167366942 19:49059305-49059327 CCACCTGGGTAGGCTGGGTGGGG + Intronic
1167813509 19:51856745-51856767 CAAGATCGGGGGGCTGAGGGAGG + Intronic
1168122017 19:54256884-54256906 CAACCCCGGGCAGCTGGGGGTGG - Intronic
1168240986 19:55088815-55088837 CAAGGGCGGGGGGCGGGGTGGGG - Intergenic
927520725 2:23696466-23696488 CACCCTCGGGGGACTTGGCGTGG + Exonic
927645662 2:24875351-24875373 CACCCACGGGGGGTGGGGTGGGG - Intronic
927888816 2:26735550-26735572 CAACACTGTGGGGCTGGGTGCGG + Intergenic
928087627 2:28355840-28355862 CATCCTCAGTGGGCTGGGTGAGG - Intergenic
928279845 2:29936012-29936034 CAACCACGGGGGGCTGCCGGTGG - Intergenic
929502993 2:42506053-42506075 CAATTTGAGGGGGCTGGGTGTGG - Intronic
930574334 2:53127569-53127591 GAATCTGGGGGAGCTGGGTGAGG - Intergenic
931353391 2:61512750-61512772 CAAAGTTGGGGAGCTGGGTGCGG + Intronic
932231467 2:70087469-70087491 CAGCCTCGGCGGTCTGGGCGGGG - Exonic
934301858 2:91781162-91781184 TAACCTCAAGGGCCTGGGTGAGG + Intergenic
934568600 2:95354164-95354186 CAACCTGAGGGGGCAGGGAGAGG - Intronic
934700557 2:96436482-96436504 CAAGGTTGGGGGGCTGGGTGTGG - Intergenic
936527283 2:113249975-113249997 GAAGATAGGGGGGCTGGGTGTGG + Intronic
938067916 2:128291990-128292012 CATCCTAGGGTGGCTGTGTGGGG + Intronic
938244975 2:129769396-129769418 CTTCCTCAGGGGGCCGGGTGGGG + Intergenic
940726529 2:157342193-157342215 CAGCCTGGGGAGGCTGGGAGAGG + Intergenic
942533105 2:176933948-176933970 AAACCTGTGGGGGCTGGGTGTGG - Intergenic
944229270 2:197376827-197376849 CTACCTCTGAGGGCCGGGTGTGG + Intergenic
944777863 2:202987240-202987262 AAACATCGGGGGGCTGGGGGTGG - Intronic
946621948 2:221571554-221571576 CACCCTCGGGGCGCTGGGCTTGG + Intronic
947415419 2:229890388-229890410 TAACCTCTGTAGGCTGGGTGTGG - Intronic
948097058 2:235343668-235343690 GGACCTCAGGGGGCTGGGAGTGG + Intergenic
948403943 2:237703619-237703641 CAACCCCGGGGGGCTGGGGAAGG - Intronic
948670911 2:239568090-239568112 CCAACTCGGGGGCCGGGGTGGGG - Intergenic
948981472 2:241496968-241496990 CACCCTCGGGGGGCTGTGGCTGG + Intronic
948993286 2:241565189-241565211 CAAGCCTGGGGCGCTGGGTGGGG - Intronic
1169264373 20:4158668-4158690 CAGCCCCGGGGGCCTGAGTGAGG + Intronic
1170607020 20:17882281-17882303 CAGCTTCCGGGGGCTGGGGGTGG - Intergenic
1172531635 20:35635031-35635053 CAAACTTGGCTGGCTGGGTGTGG - Intronic
1174149986 20:48478958-48478980 CAAACTCGGGAGGCTGGCCGGGG + Intergenic
1174332192 20:49829227-49829249 AAACCTCATGGGGCTGGGCGCGG + Intronic
1174419418 20:50390005-50390027 CAACCACTGGGGGGTGGGAGGGG - Intergenic
1174568195 20:51482116-51482138 CAGACTTGGGGGGCTGGGGGTGG - Intronic
1175202151 20:57285453-57285475 GAACCCTGGGAGGCTGGGTGCGG - Intergenic
1175819283 20:61899994-61900016 CATCCTCGGGCGGCTTGGGGAGG - Intronic
1175949463 20:62575525-62575547 GAACCTGGTGGGGCAGGGTGGGG + Intergenic
1175955796 20:62608455-62608477 GCACCCCGGGGGGCTGGGCGTGG + Intergenic
1180919923 22:19516369-19516391 TAACTTGGGGTGGCTGGGTGGGG + Intronic
1181052542 22:20244575-20244597 CTCCCTGGGTGGGCTGGGTGAGG + Intronic
1181562454 22:23713880-23713902 CAGCTTCGAGGGGCCGGGTGCGG - Intergenic
1181653361 22:24274046-24274068 AAATCTCCTGGGGCTGGGTGAGG - Intronic
1181700982 22:24621080-24621102 TAACCTCAGGGGCCTGGGTGAGG + Intronic
1181722615 22:24787505-24787527 CAAGATCTGGGTGCTGGGTGTGG - Intergenic
1181966218 22:26658141-26658163 CAGGCTCGGGGGGTTGGGTCGGG - Intergenic
1182193091 22:28484400-28484422 AAAACTTTGGGGGCTGGGTGCGG - Intronic
1183311029 22:37109582-37109604 CAGCCTGGGCTGGCTGGGTGGGG - Intergenic
1183808035 22:40228812-40228834 CAGCCTCCTGGGGCTGGGCGCGG - Intronic
1183978556 22:41526893-41526915 CACCCCCTGGTGGCTGGGTGGGG + Exonic
1184528421 22:45039327-45039349 CAACTTGGCGGGGTTGGGTGGGG + Intergenic
1184608623 22:45588545-45588567 CAACTGCTGGGGGCTGGGTTGGG - Intronic
1184886965 22:47352357-47352379 CAGCCTCTGGGGTCTGGCTGTGG + Intergenic
1185140454 22:49097957-49097979 GTACCTCCGGGGGCTGGGAGAGG + Intergenic
949963265 3:9332408-9332430 TAACCTCACTGGGCTGGGTGTGG - Intronic
950138391 3:10599218-10599240 CAAAATCTGGAGGCTGGGTGTGG + Intronic
950380827 3:12613427-12613449 CACCTTCTGGGGGCGGGGTGTGG - Intronic
950495808 3:13333644-13333666 CAGCCTTTGGGAGCTGGGTGGGG + Intronic
950496695 3:13338136-13338158 CAGCCTCAGGGGACTGGGTTGGG - Intronic
951230588 3:20174078-20174100 AAACAGTGGGGGGCTGGGTGTGG - Intronic
952840285 3:37640380-37640402 CAACCTTAAGGGGCTGGGAGAGG + Intronic
954385663 3:50242561-50242583 CAAGCTAGAAGGGCTGGGTGGGG - Intronic
954649164 3:52149735-52149757 CAAGCTAGGGGACCTGGGTGGGG + Intronic
954710161 3:52501566-52501588 CAATGTGGGGAGGCTGGGTGGGG + Intronic
960960607 3:123067710-123067732 CAGGCTCGGTGGGCTGGGTGGGG + Intronic
961455729 3:127023029-127023051 CTACCTTGGTGGGCTGTGTGAGG - Intronic
961646330 3:128394713-128394735 CAGCCTTGGGGGGCTGTCTGAGG + Intronic
962492416 3:135907299-135907321 CTCCCTCGGGGGACTGAGTGAGG + Intergenic
962745794 3:138396550-138396572 CAAGCTCGGTAGGCAGGGTGGGG - Intronic
963053675 3:141164830-141164852 AAACTTCAGTGGGCTGGGTGCGG - Intergenic
963829034 3:149987540-149987562 TAAACAAGGGGGGCTGGGTGAGG + Intronic
967326269 3:188243436-188243458 AAACCTCCGGGGGCTTGGGGTGG + Intronic
968415810 4:432758-432780 GGACCTCGGGGGGCGGGGCGGGG - Intronic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
969469177 4:7376901-7376923 GAACATCCGTGGGCTGGGTGGGG - Intronic
970672471 4:18412644-18412666 CAACGTCGGGGGTCAGGGTCTGG - Intergenic
971245005 4:24919497-24919519 CAACCTTGGCGGGCAGGGGGTGG + Intronic
971583924 4:28380651-28380673 GAACCTAAGGAGGCTGGGTGTGG + Intronic
972636336 4:40887133-40887155 CAACCCTGGGGGGCTCAGTGGGG + Intronic
973964313 4:56145725-56145747 CTACTTTGGGGGGCTGAGTGAGG - Intergenic
974040042 4:56849399-56849421 TAACCTCTGGAGGCTGGGTACGG + Intergenic
978030631 4:103937066-103937088 CACCCGTGGGGGGCGGGGTGGGG - Intergenic
978114613 4:105004416-105004438 CAAAGTTTGGGGGCTGGGTGCGG + Intergenic
978165635 4:105603370-105603392 GACCCTCGGGAGGATGGGTGAGG + Intronic
981025798 4:140076050-140076072 CAACATAGGGAGGCTGGGTGTGG - Intronic
981189205 4:141840998-141841020 TAGCCTGGGGAGGCTGGGTGTGG - Intergenic
984185483 4:176538027-176538049 CAACCTCAGGGCCCTGGTTGTGG - Intergenic
985293033 4:188405762-188405784 CAACCATGGGGGACTGGGTGAGG - Intergenic
990230895 5:53712224-53712246 GAACCTGGGGGGTCTGGATGAGG - Intergenic
990946874 5:61259017-61259039 AAACCTGGAAGGGCTGGGTGCGG + Intergenic
991684870 5:69172545-69172567 AAACAACTGGGGGCTGGGTGCGG - Intronic
996670288 5:126110181-126110203 CAACTGCAGGGGGCGGGGTGTGG + Intergenic
997267247 5:132502021-132502043 CCACCTCGGAGTGCTGGATGAGG + Intergenic
997824465 5:137093855-137093877 GAACCTGGGGGAGCAGGGTGAGG + Intronic
999124813 5:149239339-149239361 CACCTTCGGGGGGCTGGGGATGG - Intronic
999461126 5:151758391-151758413 CAAAAGCTGGGGGCTGGGTGGGG + Intronic
1002092740 5:176814463-176814485 CAACGTTGGGGTGTTGGGTGGGG - Intronic
1003139006 6:3456280-3456302 CTTCCTCGGGGGCCTGGGCGGGG - Exonic
1003235792 6:4294454-4294476 CAGCCTCTGGGGGCAAGGTGAGG - Intergenic
1004297052 6:14422516-14422538 CCACCTTCCGGGGCTGGGTGCGG + Intergenic
1006413305 6:33888345-33888367 CTTTCTCGGGGGGCAGGGTGGGG - Intergenic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1009035945 6:58117346-58117368 CAACATCAGGGGACAGGGTGAGG + Intergenic
1010059958 6:71611112-71611134 CAACCTCGGGAGGCTGAGGGAGG + Intergenic
1011455236 6:87541531-87541553 AAACCTCTGGAGGCTGGGCGTGG + Intronic
1013048760 6:106512110-106512132 CGCCCTTGGGGGGCTGGCTGCGG - Exonic
1013252690 6:108349975-108349997 CAACTTTGGGGGGCTGAGGGGGG + Intronic
1014252804 6:119131727-119131749 ATACTTTGGGGGGCTGGGTGGGG - Intronic
1014449029 6:121562270-121562292 TGACCTCTGGTGGCTGGGTGTGG + Intergenic
1017130924 6:151107699-151107721 ATACCTAGGGTGGCTGGGTGTGG - Intergenic
1017653122 6:156601266-156601288 CATCCCCAGAGGGCTGGGTGTGG - Intergenic
1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG + Intronic
1019450816 7:1096866-1096888 CAGTCTTGGGGGGCAGGGTGGGG + Intronic
1019504025 7:1381698-1381720 CACCCTTGGGGGGCTGGGAGGGG - Intergenic
1019522674 7:1467781-1467803 CACCCTGGGGTGGGTGGGTGGGG + Intergenic
1019662848 7:2234643-2234665 GAAAATCTGGGGGCTGGGTGAGG - Exonic
1019700921 7:2474786-2474808 CACCCTGGGGCAGCTGGGTGAGG - Intergenic
1020106002 7:5422634-5422656 CCTGCTCGGGGGGCTGGGCGCGG - Intronic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1021915287 7:25425661-25425683 CAACCACGGTGGGCTGAGTTGGG - Intergenic
1022091797 7:27113044-27113066 CAAACTTTGGGGGCTGGGTTGGG - Intronic
1022207539 7:28179611-28179633 CGACCCCGGGGCGCTGGGCGCGG + Intronic
1025251527 7:57354477-57354499 CAACCACTGGGGGATGGGAGGGG + Intergenic
1026277145 7:68889926-68889948 CCACCTCATGGGGCTGGGTGAGG - Intergenic
1026294339 7:69038081-69038103 CAAACTGGTGGGGCTGTGTGGGG - Intergenic
1026642633 7:72140584-72140606 CAACCTTGGCAGGCAGGGTGTGG + Intronic
1026936571 7:74259990-74260012 CAGCCTCGGAGGGGTGGGAGTGG + Intergenic
1027186856 7:75977483-75977505 ATACCTCAGGTGGCTGGGTGCGG + Intronic
1027244625 7:76358806-76358828 CATCTTCGCGGGGCTGGGTCTGG + Exonic
1029116692 7:98241296-98241318 CAAGCACGGGGGTCTCGGTGTGG + Intronic
1030007390 7:105132655-105132677 CATCCACCGTGGGCTGGGTGAGG - Intronic
1030288639 7:107850536-107850558 CAAGATCTGGGGGCTGGCTGTGG - Intergenic
1035020307 7:155796912-155796934 CAGCCTCGGGGGGCTGGGGCCGG - Intergenic
1035353495 7:158263597-158263619 GAGCCTCTGGGTGCTGGGTGAGG + Intronic
1035745350 8:1958686-1958708 CAACCTCGGGGGGCTGGGTGGGG + Intergenic
1036709491 8:11068998-11069020 CAACCTCGGGGTCCTGATTGTGG + Intronic
1037899274 8:22678085-22678107 CAACCTAGGGGAGCTGGAGGAGG + Intergenic
1039065874 8:33607004-33607026 CAACCATCTGGGGCTGGGTGAGG - Intergenic
1040042714 8:42932573-42932595 AAATGTCAGGGGGCTGGGTGAGG - Intronic
1042226824 8:66520849-66520871 CAACACCTGAGGGCTGGGTGTGG - Intergenic
1045555264 8:103209079-103209101 CAACATCTGGAGGCTGGGTGTGG + Intronic
1046395479 8:113633661-113633683 CACCCTCAGTGGGGTGGGTGTGG + Intergenic
1047104763 8:121720281-121720303 CACCCTCGGGGGCCTGGGAAGGG - Intergenic
1047702385 8:127462065-127462087 AAAGCAAGGGGGGCTGGGTGGGG + Intergenic
1049552025 8:143264441-143264463 CAGGCTGGGGGGGCTGGCTGTGG + Intronic
1049641640 8:143718705-143718727 CAACCTGGGGGGAGTGGGAGAGG - Intronic
1049658881 8:143810898-143810920 CAACCTACCGAGGCTGGGTGGGG + Exonic
1049808002 8:144549781-144549803 AAACCACGTGGGGCTGGGCGCGG - Intronic
1049855869 8:144861546-144861568 CAACCAGGGGGGACTGGGTCTGG - Intergenic
1052647552 9:31254977-31254999 CTACCTCGGGAGGCTGGGGCAGG + Intergenic
1056641034 9:88370800-88370822 CAAAATAGGCGGGCTGGGTGCGG + Intergenic
1057468138 9:95334831-95334853 CAACTTCCTTGGGCTGGGTGTGG + Intergenic
1060184763 9:121557626-121557648 CAAGCTCTGGGGGCTGGGAAAGG + Intergenic
1060432717 9:123564267-123564289 CAACTTCTGGGGCCTGGGAGTGG + Intronic
1060592764 9:124829385-124829407 CAGCCTCGGGTGGGTGGGGGTGG - Intergenic
1061306983 9:129737885-129737907 CGGCCTCGGGGTGCTGGGAGGGG + Intergenic
1061757911 9:132827974-132827996 AAACCCCATGGGGCTGGGTGGGG + Intronic
1062135161 9:134922963-134922985 TAATCTCGAGGGGCAGGGTGCGG - Intergenic
1186970187 X:14833654-14833676 TCACCTGGGGAGGCTGGGTGTGG + Intergenic
1189222296 X:39382863-39382885 GAAGCTTTGGGGGCTGGGTGCGG - Intergenic
1189493174 X:41485656-41485678 CATCCTTGGGTGGTTGGGTGGGG - Intergenic
1191103784 X:56759865-56759887 GAACTTCGGGGTGCTGGGGGCGG - Intergenic
1192495804 X:71616145-71616167 CCACCTCGGGCGGCAGGATGGGG + Exonic
1195327900 X:103773002-103773024 CAACAGCCGGGGGCTGGGGGAGG - Intergenic
1196874742 X:120147199-120147221 CAACCTAGAGTGGCTGGGGGCGG + Intergenic
1198328251 X:135595982-135596004 CAACATTGGGGGGTTGGGGGAGG - Intergenic
1198338209 X:135689017-135689039 CAACATTGGGGGGTTGGGGGAGG + Intergenic
1199661927 X:150060134-150060156 CTTCCTCAGGAGGCTGGGTGTGG + Intergenic
1199895171 X:152120128-152120150 AAGCCACGGGGGGCTGGGGGCGG + Intergenic
1200253518 X:154566692-154566714 CAGCATCTGGGGGCGGGGTGTGG + Intergenic
1200264249 X:154637716-154637738 CAGCATCTGGGGGCGGGGTGTGG - Intergenic
1201601263 Y:15730788-15730810 TAATGGCGGGGGGCTGGGTGGGG + Intergenic
1201755901 Y:17484930-17484952 CAACCCAGAGTGGCTGGGTGTGG - Intergenic
1201845651 Y:18421055-18421077 CAACCCAGAGTGGCTGGGTGTGG + Intergenic
1201892887 Y:18962069-18962091 AAACCTAGGCAGGCTGGGTGTGG + Intergenic