ID: 1035745560

View in Genome Browser
Species Human (GRCh38)
Location 8:1960037-1960059
Sequence TGATCAACAAGGAGCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035745546_1035745560 21 Left 1035745546 8:1959993-1960015 CCCAGCTTCCGGGCCCCCATCTG No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745553_1035745560 6 Left 1035745553 8:1960008-1960030 CCCATCTGCTGGGTAGACCCTCG No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745547_1035745560 20 Left 1035745547 8:1959994-1960016 CCAGCTTCCGGGCCCCCATCTGC No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745545_1035745560 22 Left 1035745545 8:1959992-1960014 CCCCAGCTTCCGGGCCCCCATCT No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745550_1035745560 13 Left 1035745550 8:1960001-1960023 CCGGGCCCCCATCTGCTGGGTAG No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745551_1035745560 8 Left 1035745551 8:1960006-1960028 CCCCCATCTGCTGGGTAGACCCT No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745544_1035745560 23 Left 1035745544 8:1959991-1960013 CCCCCAGCTTCCGGGCCCCCATC No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745554_1035745560 5 Left 1035745554 8:1960009-1960031 CCATCTGCTGGGTAGACCCTCGG No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data
1035745552_1035745560 7 Left 1035745552 8:1960007-1960029 CCCCATCTGCTGGGTAGACCCTC No data
Right 1035745560 8:1960037-1960059 TGATCAACAAGGAGCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035745560 Original CRISPR TGATCAACAAGGAGCCTGGC TGG Intergenic
No off target data available for this crispr