ID: 1035745727

View in Genome Browser
Species Human (GRCh38)
Location 8:1961072-1961094
Sequence CCCAGGTGACCTAGGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035745718_1035745727 29 Left 1035745718 8:1961020-1961042 CCACAGGGTCACTACTGTGTCGA No data
Right 1035745727 8:1961072-1961094 CCCAGGTGACCTAGGAATGCAGG No data
1035745723_1035745727 -7 Left 1035745723 8:1961056-1961078 CCTGGACCTGGGAGAACCCAGGT No data
Right 1035745727 8:1961072-1961094 CCCAGGTGACCTAGGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035745727 Original CRISPR CCCAGGTGACCTAGGAATGC AGG Intergenic
No off target data available for this crispr