ID: 1035745985

View in Genome Browser
Species Human (GRCh38)
Location 8:1962389-1962411
Sequence AGCCCACGATGCTGAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035745985_1035745990 -5 Left 1035745985 8:1962389-1962411 CCCCCAGCTCAGCATCGTGGGCT No data
Right 1035745990 8:1962407-1962429 GGGCTCCCTGGCACCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035745985 Original CRISPR AGCCCACGATGCTGAGCTGG GGG (reversed) Intergenic