ID: 1035746213

View in Genome Browser
Species Human (GRCh38)
Location 8:1963525-1963547
Sequence CTCTGGATCTCAGAGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746213_1035746222 21 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data
1035746213_1035746218 -6 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746218 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
1035746213_1035746223 28 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data
1035746213_1035746220 5 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746220 8:1963553-1963575 TGTACATTCCGGTTCTAAGCGGG No data
1035746213_1035746219 4 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746219 8:1963552-1963574 CTGTACATTCCGGTTCTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746213 Original CRISPR CTCTGGATCTCAGAGGCTGC CGG (reversed) Intergenic
No off target data available for this crispr