ID: 1035746216

View in Genome Browser
Species Human (GRCh38)
Location 8:1963532-1963554
Sequence CAGAACCCTCTGGATCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746216_1035746220 -2 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746220 8:1963553-1963575 TGTACATTCCGGTTCTAAGCGGG No data
1035746216_1035746223 21 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data
1035746216_1035746226 27 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746226 8:1963582-1963604 GTGTAGATGGCACATGGCCAAGG No data
1035746216_1035746227 28 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746227 8:1963583-1963605 TGTAGATGGCACATGGCCAAGGG No data
1035746216_1035746219 -3 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746219 8:1963552-1963574 CTGTACATTCCGGTTCTAAGCGG No data
1035746216_1035746222 14 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746216 Original CRISPR CAGAACCCTCTGGATCTCAG AGG (reversed) Intergenic
No off target data available for this crispr