ID: 1035746217

View in Genome Browser
Species Human (GRCh38)
Location 8:1963542-1963564
Sequence CCGGAATGTACAGAACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746217_1035746226 17 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746226 8:1963582-1963604 GTGTAGATGGCACATGGCCAAGG No data
1035746217_1035746227 18 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746227 8:1963583-1963605 TGTAGATGGCACATGGCCAAGGG No data
1035746217_1035746222 4 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data
1035746217_1035746223 11 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data
1035746217_1035746228 21 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746228 8:1963586-1963608 AGATGGCACATGGCCAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746217 Original CRISPR CCGGAATGTACAGAACCCTC TGG (reversed) Intergenic
No off target data available for this crispr