ID: 1035746221

View in Genome Browser
Species Human (GRCh38)
Location 8:1963561-1963583
Sequence ACAGGGTGCCCGCTTAGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746221_1035746230 22 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746230 8:1963606-1963628 TGGCAGAACCGCCTTTTCCAAGG No data
1035746221_1035746227 -1 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746227 8:1963583-1963605 TGTAGATGGCACATGGCCAAGGG No data
1035746221_1035746226 -2 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746226 8:1963582-1963604 GTGTAGATGGCACATGGCCAAGG No data
1035746221_1035746228 2 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746228 8:1963586-1963608 AGATGGCACATGGCCAAGGGTGG No data
1035746221_1035746223 -8 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746221 Original CRISPR ACAGGGTGCCCGCTTAGAAC CGG (reversed) Intergenic
No off target data available for this crispr