ID: 1035746222

View in Genome Browser
Species Human (GRCh38)
Location 8:1963569-1963591
Sequence AAGCGGGCACCCTGTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746213_1035746222 21 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data
1035746217_1035746222 4 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data
1035746211_1035746222 30 Left 1035746211 8:1963516-1963538 CCCAAAGAGCCGGCAGCCTCTGA No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data
1035746216_1035746222 14 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data
1035746212_1035746222 29 Left 1035746212 8:1963517-1963539 CCAAAGAGCCGGCAGCCTCTGAG No data
Right 1035746222 8:1963569-1963591 AAGCGGGCACCCTGTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746222 Original CRISPR AAGCGGGCACCCTGTGTAGA TGG Intergenic
No off target data available for this crispr