ID: 1035746223

View in Genome Browser
Species Human (GRCh38)
Location 8:1963576-1963598
Sequence CACCCTGTGTAGATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035746217_1035746223 11 Left 1035746217 8:1963542-1963564 CCAGAGGGTTCTGTACATTCCGG No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data
1035746216_1035746223 21 Left 1035746216 8:1963532-1963554 CCTCTGAGATCCAGAGGGTTCTG No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data
1035746221_1035746223 -8 Left 1035746221 8:1963561-1963583 CCGGTTCTAAGCGGGCACCCTGT No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data
1035746213_1035746223 28 Left 1035746213 8:1963525-1963547 CCGGCAGCCTCTGAGATCCAGAG No data
Right 1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035746223 Original CRISPR CACCCTGTGTAGATGGCACA TGG Intergenic
No off target data available for this crispr